Incidental Mutation 'R5575:Hk3'
ID437184
Institutional Source Beutler Lab
Gene Symbol Hk3
Ensembl Gene ENSMUSG00000025877
Gene Namehexokinase 3
Synonyms
MMRRC Submission 043130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5575 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55005985-55021385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55014770 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 88 (D88E)
Ref Sequence ENSEMBL: ENSMUSP00000117254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052949] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000148221] [ENSMUST00000153665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052949
AA Change: D88E

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877
AA Change: D88E

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123097
AA Change: D88E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877
AA Change: D88E

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126234
AA Change: D88E

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877
AA Change: D88E

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132309
AA Change: D88E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877
AA Change: D88E

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135983
Predicted Effect probably benign
Transcript: ENSMUST00000148221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149644
Predicted Effect possibly damaging
Transcript: ENSMUST00000153665
AA Change: D33E

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877
AA Change: D33E

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Aplf A C 6: 87,646,147 C338G probably benign Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col9a3 A T 2: 180,598,846 probably benign Het
Dsc2 A T 18: 20,035,390 C671S probably damaging Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Thada A C 17: 84,416,399 probably null Het
Themis3 A G 17: 66,555,326 S546P possibly damaging Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in Hk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Hk3 APN 13 55014426 critical splice donor site probably null
IGL01314:Hk3 APN 13 55007063 splice site probably benign
IGL02043:Hk3 APN 13 55015095 missense probably damaging 1.00
IGL02197:Hk3 APN 13 55014468 missense probably damaging 1.00
IGL02619:Hk3 APN 13 55014294 missense probably damaging 1.00
R0454:Hk3 UTSW 13 55008705 missense probably damaging 1.00
R0518:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0521:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0709:Hk3 UTSW 13 55014730 missense probably damaging 1.00
R1386:Hk3 UTSW 13 55007030 intron probably null
R1567:Hk3 UTSW 13 55006605 missense probably damaging 1.00
R1647:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1648:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1663:Hk3 UTSW 13 55006575 missense probably benign 0.00
R1936:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1940:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1966:Hk3 UTSW 13 55014455 missense probably damaging 1.00
R2345:Hk3 UTSW 13 55008993 missense probably damaging 1.00
R4838:Hk3 UTSW 13 55006418 missense probably damaging 1.00
R4852:Hk3 UTSW 13 55012596 missense probably damaging 0.99
R4883:Hk3 UTSW 13 55010922 missense probably benign 0.04
R4888:Hk3 UTSW 13 55006592 missense probably damaging 1.00
R5100:Hk3 UTSW 13 55009030 missense probably damaging 1.00
R5253:Hk3 UTSW 13 55011011 missense probably damaging 1.00
R5328:Hk3 UTSW 13 55013493 missense probably benign 0.00
R5441:Hk3 UTSW 13 55015056 missense probably damaging 1.00
R5493:Hk3 UTSW 13 55011171 missense probably damaging 1.00
R5557:Hk3 UTSW 13 55012075 nonsense probably null
R5578:Hk3 UTSW 13 55012181 missense probably damaging 1.00
R5686:Hk3 UTSW 13 55006813 missense probably damaging 1.00
R5872:Hk3 UTSW 13 55010804 missense probably damaging 1.00
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6314:Hk3 UTSW 13 55013580 missense probably benign 0.02
R6315:Hk3 UTSW 13 55011157 missense probably benign 0.03
R6797:Hk3 UTSW 13 55010831 splice site probably null
R6827:Hk3 UTSW 13 55011352 missense probably damaging 0.98
R6860:Hk3 UTSW 13 55014465 missense probably damaging 0.98
R7082:Hk3 UTSW 13 55006897 missense probably benign 0.40
R7227:Hk3 UTSW 13 55012240 missense probably benign 0.00
R7564:Hk3 UTSW 13 55011396 missense probably damaging 1.00
X0003:Hk3 UTSW 13 55007136 missense probably benign 0.01
Z1177:Hk3 UTSW 13 55010708 missense probably damaging 1.00
Z1177:Hk3 UTSW 13 55010710 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGAAGCGTGCTTAGCTCTGAC -3'
(R):5'- TAACACAGACTCGGATGGGC -3'

Sequencing Primer
(F):5'- TTAGCTCTGACCGCCCAG -3'
(R):5'- GATGGGCGGCCAGACAC -3'
Posted On2016-10-26