Incidental Mutation 'R5575:Dsc2'
ID 437196
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2b, Dsc2a
MMRRC Submission 043130-MU
Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene? Non essential (E-score: 0.000) question?
Stock # R5575 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20030633-20059554 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20035390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 671 (C671S)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: C671S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: C671S

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: C671S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: C671S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155407
AA Change: C70S
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: C70S

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Aplf A C 6: 87,646,147 C338G probably benign Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col9a3 A T 2: 180,598,846 probably benign Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hk3 A T 13: 55,014,770 D88E probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Thada A C 17: 84,416,399 probably null Het
Themis3 A G 17: 66,555,326 S546P possibly damaging Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20034665 nonsense probably null
R9005:Dsc2 UTSW 18 20038094 missense probably benign 0.00
R9017:Dsc2 UTSW 18 20043911 missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20034707 missense probably benign 0.00
R9396:Dsc2 UTSW 18 20041716 nonsense probably null
R9487:Dsc2 UTSW 18 20047219 missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20038148 missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTATCACTTTTCAGACCACTACC -3'
(R):5'- AACTGGCCGGGTTTGCTTAAG -3'

Sequencing Primer
(F):5'- TCACTTTTCAGACCACTACCTATAAG -3'
(R):5'- GAAGCTTTTGTATGTAACACCTGC -3'
Posted On 2016-10-26