Incidental Mutation 'R5576:BC034090'
ID437199
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 155241468 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 301 (K301N)
Ref Sequence ENSEMBL: ENSMUSP00000139623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186156]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186082
Predicted Effect probably benign
Transcript: ENSMUST00000186156
AA Change: K301N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: K301N

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7569:BC034090 UTSW 1 155217405 missense probably benign 0.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATAGCCTCCCACTGACCTG -3'
(R):5'- ACAATACCCGCTCGGAGATG -3'

Sequencing Primer
(F):5'- CCACAGGGTTGGAGGCAGTTAG -3'
(R):5'- CGCTCGGAGATGGGATAGTCAC -3'
Posted On2016-10-26