Incidental Mutation 'R5576:Sycp1'
ID437200
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102818902 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 969 (R969G)
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
Predicted Effect probably damaging
Transcript: ENSMUST00000029448
AA Change: R969G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: R969G

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196988
AA Change: R969G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: R969G

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198651
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATTAACTATTCAGAGACCCTCAC -3'
(R):5'- GAGCCTGGTTTCAGAGGAAG -3'

Sequencing Primer
(F):5'- CTTCGAACTTCAATATCCATTGCAAG -3'
(R):5'- AGCCTGGTTTCAGAGGAAGATGTATC -3'
Posted On2016-10-26