Incidental Mutation 'R5576:Melk'
ID437201
Institutional Source Beutler Lab
Gene Symbol Melk
Ensembl Gene ENSMUSG00000035683
Gene Namematernal embryonic leucine zipper kinase
SynonymsMPK38
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location44300876-44364675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44312255 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 141 (E141G)
Ref Sequence ENSEMBL: ENSMUSP00000120242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045607] [ENSMUST00000125708] [ENSMUST00000137703]
Predicted Effect probably null
Transcript: ENSMUST00000045607
AA Change: E189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043806
Gene: ENSMUSG00000035683
AA Change: E189G

DomainStartEndE-ValueType
S_TKc 11 263 2.64e-105 SMART
low complexity region 313 325 N/A INTRINSIC
Pfam:KA1 599 643 2.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118668
Predicted Effect probably null
Transcript: ENSMUST00000125708
AA Change: E118G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118359
Gene: ENSMUSG00000035683
AA Change: E118G

DomainStartEndE-ValueType
Pfam:Pkinase 11 91 1.9e-15 PFAM
Pfam:Pkinase_Tyr 11 97 4.3e-10 PFAM
Pfam:Pkinase 88 134 6.7e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137703
AA Change: E141G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120242
Gene: ENSMUSG00000035683
AA Change: E141G

DomainStartEndE-ValueType
Pfam:Pkinase 11 88 7.7e-15 PFAM
Pfam:Pkinase_Tyr 11 88 3.1e-9 PFAM
Pfam:Pkinase_Tyr 87 212 1.5e-15 PFAM
Pfam:Pkinase 87 215 3.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137759
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an allele that produces a kinase-dead protein exhibit altered pancreatic regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Melk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Melk APN 4 44347262 missense probably benign 0.05
IGL01367:Melk APN 4 44332907 missense possibly damaging 0.62
IGL01865:Melk APN 4 44344988 missense probably benign 0.00
IGL02801:Melk APN 4 44360930 missense probably damaging 0.99
R0037:Melk UTSW 4 44360864 splice site probably benign
R0433:Melk UTSW 4 44340614 splice site probably benign
R0570:Melk UTSW 4 44308906 missense probably damaging 1.00
R0786:Melk UTSW 4 44303649 missense unknown
R1483:Melk UTSW 4 44308937 missense probably damaging 1.00
R2042:Melk UTSW 4 44309051 critical splice donor site probably null
R3831:Melk UTSW 4 44345021 missense probably benign 0.05
R5060:Melk UTSW 4 44350959 missense probably benign 0.15
R5236:Melk UTSW 4 44344959 missense probably benign
R5269:Melk UTSW 4 44363730 missense probably damaging 1.00
R5357:Melk UTSW 4 44363730 missense probably damaging 1.00
R5358:Melk UTSW 4 44363730 missense probably damaging 1.00
R5360:Melk UTSW 4 44363730 missense probably damaging 1.00
R5430:Melk UTSW 4 44309033 missense probably damaging 1.00
R5656:Melk UTSW 4 44312237 missense possibly damaging 0.95
R5738:Melk UTSW 4 44310333 missense probably damaging 1.00
R5972:Melk UTSW 4 44351007 missense probably benign 0.01
R6265:Melk UTSW 4 44318109 missense probably damaging 1.00
R6340:Melk UTSW 4 44340633 missense probably damaging 1.00
R7202:Melk UTSW 4 44351106 missense probably benign
R7242:Melk UTSW 4 44360885 missense probably damaging 1.00
R7328:Melk UTSW 4 44332931 missense probably benign
R7608:Melk UTSW 4 44325571 splice site probably null
R8053:Melk UTSW 4 44318109 missense probably damaging 1.00
R8185:Melk UTSW 4 44360965 missense probably benign 0.14
R8356:Melk UTSW 4 44312191 missense possibly damaging 0.75
R8456:Melk UTSW 4 44312191 missense possibly damaging 0.75
X0020:Melk UTSW 4 44349876 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCAGAATTCCTCACTTTGGGG -3'
(R):5'- GACTGAACTAAGACACAAGTGC -3'

Sequencing Primer
(F):5'- GGCTGAGTCTGACCTTGAACTC -3'
(R):5'- TTTAATCCCAGCACTCAGGAGG -3'
Posted On2016-10-26