Incidental Mutation 'R5576:Snx2'
ID437238
Institutional Source Beutler Lab
Gene Symbol Snx2
Ensembl Gene ENSMUSG00000034484
Gene Namesorting nexin 2
Synonyms0610030A03Rik
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location53176365-53220860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53210750 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 322 (K322E)
Ref Sequence ENSEMBL: ENSMUSP00000039243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037850]
Predicted Effect probably benign
Transcript: ENSMUST00000037850
AA Change: K322E

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484
AA Change: K322E

DomainStartEndE-ValueType
Pfam:Sorting_nexin 2 134 1.6e-29 PFAM
PX 138 265 1.4e-38 SMART
Pfam:Vps5 281 514 2.2e-90 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Snx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Snx2 APN 18 53216400 missense possibly damaging 0.95
IGL00861:Snx2 APN 18 53210797 splice site probably null
IGL01116:Snx2 APN 18 53194423 splice site probably benign
IGL01642:Snx2 APN 18 53216447 missense probably damaging 0.99
IGL02178:Snx2 APN 18 53199785 missense possibly damaging 0.61
IGL02368:Snx2 APN 18 53189721 missense probably benign
IGL02597:Snx2 APN 18 53210372 missense probably benign 0.09
IGL02964:Snx2 APN 18 53194558 missense probably benign 0.00
IGL03372:Snx2 APN 18 53216391 missense probably damaging 1.00
blanched UTSW 18 53194444 missense probably damaging 0.98
bleached UTSW 18 53197925 splice site probably null
R0332:Snx2 UTSW 18 53212911 missense probably benign 0.01
R0723:Snx2 UTSW 18 53210372 missense probably benign 0.09
R0746:Snx2 UTSW 18 53197889 missense possibly damaging 0.90
R0826:Snx2 UTSW 18 53194522 missense probably benign 0.00
R0894:Snx2 UTSW 18 53176416 missense probably benign
R0970:Snx2 UTSW 18 53210690 splice site probably benign
R1897:Snx2 UTSW 18 53197878 missense probably damaging 0.99
R2049:Snx2 UTSW 18 53194444 missense probably damaging 0.98
R2910:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R2911:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R4460:Snx2 UTSW 18 53176444 missense probably benign 0.31
R5225:Snx2 UTSW 18 53189712 missense possibly damaging 0.91
R5352:Snx2 UTSW 18 53197925 splice site probably null
R5450:Snx2 UTSW 18 53210712 missense probably damaging 0.99
R5965:Snx2 UTSW 18 53194462 nonsense probably null
R6063:Snx2 UTSW 18 53209625 nonsense probably null
R6222:Snx2 UTSW 18 53199824 nonsense probably null
R6291:Snx2 UTSW 18 53209665 critical splice donor site probably null
R6890:Snx2 UTSW 18 53212879 missense probably damaging 1.00
R7380:Snx2 UTSW 18 53194568 missense probably benign
R8081:Snx2 UTSW 18 53216387 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTTATTGAGTTCAGTTCTCAGCTAC -3'
(R):5'- TCTGTTTTGAGACAGCCTAGCG -3'

Sequencing Primer
(F):5'- TACATCAGTTGACCACCGTGG -3'
(R):5'- TTTTGAGACAGCCTAGCGTCAGAC -3'
Posted On2016-10-26