Incidental Mutation 'R0046:Rtcb'
ID 43724
Institutional Source Beutler Lab
Gene Symbol Rtcb
Ensembl Gene ENSMUSG00000001783
Gene Name RNA 2',3'-cyclic phosphate and 5'-OH ligase
Synonyms HSPC117, D10Wsu52e
MMRRC Submission 038340-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R0046 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 85774501-85793657 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85793520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 18 (N18D)
Ref Sequence ENSEMBL: ENSMUSP00000001834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001834] [ENSMUST00000061699]
AlphaFold Q99LF4
Predicted Effect probably benign
Transcript: ENSMUST00000001834
AA Change: N18D

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000001834
Gene: ENSMUSG00000001783
AA Change: N18D

DomainStartEndE-ValueType
Pfam:RtcB 61 505 3.3e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061699
SMART Domains Protein: ENSMUSP00000063107
Gene: ENSMUSG00000050108

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
BPI1 33 257 8.89e-23 SMART
BPI2 272 474 2.29e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218274
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: Mice lacking expression in B cells show impaired immunoglobin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 (GRCm39) K135* probably null Het
Adamts16 A G 13: 70,911,579 (GRCm39) S871P probably benign Het
Adcy10 A T 1: 165,367,403 (GRCm39) I558F probably damaging Het
Adsl T G 15: 80,846,989 (GRCm39) probably null Het
Aldob T C 4: 49,543,842 (GRCm39) I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 (GRCm39) E46G probably damaging Het
Ankrd33b G A 15: 31,367,483 (GRCm39) P19L probably damaging Het
Apoa5 T C 9: 46,181,296 (GRCm39) L124S probably damaging Het
Atp1a4 A T 1: 172,067,664 (GRCm39) L533Q probably benign Het
Atp7b T C 8: 22,550,011 (GRCm39) T9A probably benign Het
Auh G A 13: 53,083,421 (GRCm39) probably benign Het
B3gnt3 T C 8: 72,145,567 (GRCm39) Y267C probably damaging Het
Card11 T C 5: 140,894,279 (GRCm39) T117A possibly damaging Het
Ccdc39 A G 3: 33,898,301 (GRCm39) F15L possibly damaging Het
Chtf18 C T 17: 25,942,434 (GRCm39) R468Q probably benign Het
Cntnap5c T G 17: 58,666,295 (GRCm39) D1108E probably benign Het
Col14a1 G A 15: 55,272,359 (GRCm39) probably benign Het
Col6a6 C T 9: 105,626,047 (GRCm39) probably benign Het
Col9a3 G A 2: 180,251,280 (GRCm39) A317T possibly damaging Het
Cpt1c A T 7: 44,609,256 (GRCm39) probably benign Het
Cpt2 A G 4: 107,761,559 (GRCm39) probably null Het
Crebrf T A 17: 26,982,308 (GRCm39) L565M probably damaging Het
Cyp2d41-ps T A 15: 82,666,236 (GRCm39) noncoding transcript Het
Dhx9 C T 1: 153,348,453 (GRCm39) V291M probably benign Het
Dmxl1 T A 18: 50,011,149 (GRCm39) V1102E probably benign Het
Dnah7a A T 1: 53,496,033 (GRCm39) probably null Het
Dock4 G A 12: 40,787,359 (GRCm39) probably benign Het
Dpp3 G T 19: 4,964,671 (GRCm39) N545K probably damaging Het
Elmo2 T A 2: 165,140,646 (GRCm39) N275I probably damaging Het
Farp1 A G 14: 121,492,925 (GRCm39) K509R probably benign Het
Fat3 T C 9: 15,877,275 (GRCm39) Y3446C possibly damaging Het
Fgd2 T A 17: 29,593,964 (GRCm39) probably benign Het
Flg T A 3: 93,185,028 (GRCm39) probably benign Het
Gas2l2 A T 11: 83,312,736 (GRCm39) W859R probably damaging Het
Gatm T C 2: 122,431,225 (GRCm39) D254G probably damaging Het
Gjd4 T A 18: 9,280,998 (GRCm39) I27F probably damaging Het
Gsdmc2 C A 15: 63,699,604 (GRCm39) probably benign Het
Haus5 C T 7: 30,353,605 (GRCm39) V591I probably benign Het
Kcnab3 G A 11: 69,221,053 (GRCm39) probably null Het
Khdrbs2 A G 1: 32,658,283 (GRCm39) D281G possibly damaging Het
Krt86 A T 15: 101,375,283 (GRCm39) M393L probably benign Het
Limk1 T C 5: 134,701,615 (GRCm39) Y96C probably damaging Het
Lrp2bp T A 8: 46,466,192 (GRCm39) Y100* probably null Het
Mamstr T G 7: 45,291,194 (GRCm39) probably benign Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Marf1 G A 16: 13,929,591 (GRCm39) P1672S possibly damaging Het
Mboat7 T C 7: 3,686,817 (GRCm39) Y341C probably damaging Het
Nhsl1 A T 10: 18,401,417 (GRCm39) N881I probably damaging Het
Nox3 T C 17: 3,733,236 (GRCm39) Y225C probably benign Het
Nrp1 C T 8: 129,227,089 (GRCm39) probably benign Het
Or11g26 T A 14: 50,753,596 (GRCm39) *312K probably null Het
Or4c109 C T 2: 88,817,693 (GRCm39) M284I probably benign Het
Or4c35 C T 2: 89,808,851 (GRCm39) T243I probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or8k33 A G 2: 86,383,976 (GRCm39) F164S probably damaging Het
Pcdhb13 A T 18: 37,577,310 (GRCm39) M563L probably benign Het
Pclo C T 5: 14,590,493 (GRCm39) T931M unknown Het
Peli2 C T 14: 48,358,659 (GRCm39) P16S possibly damaging Het
Pfas G T 11: 68,881,293 (GRCm39) R1025S probably benign Het
Pik3c2a A T 7: 115,953,307 (GRCm39) I1196N probably damaging Het
Pmfbp1 A T 8: 110,262,617 (GRCm39) probably benign Het
Prg4 T C 1: 150,331,837 (GRCm39) T279A possibly damaging Het
Psma1 A T 7: 113,866,440 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,643,149 (GRCm39) L550P probably damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Rmnd5a T C 6: 71,376,215 (GRCm39) H195R probably damaging Het
Rnf17 T C 14: 56,708,830 (GRCm39) L750P probably damaging Het
Seh1l T C 18: 67,925,086 (GRCm39) probably null Het
Sis T G 3: 72,839,427 (GRCm39) N813T probably benign Het
Sptbn2 T C 19: 4,795,405 (GRCm39) probably benign Het
Stag3 C T 5: 138,281,285 (GRCm39) probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Taok3 C T 5: 117,410,294 (GRCm39) Q829* probably null Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tsbp1 T C 17: 34,679,095 (GRCm39) probably null Het
Ttn A G 2: 76,781,886 (GRCm39) probably benign Het
Unc79 A G 12: 103,091,940 (GRCm39) E1756G probably damaging Het
Usp35 A T 7: 96,962,804 (GRCm39) probably null Het
Vmn2r111 A G 17: 22,766,990 (GRCm39) F836L probably benign Het
Vmn2r77 A G 7: 86,451,146 (GRCm39) D344G possibly damaging Het
Zbtb40 A G 4: 136,714,589 (GRCm39) C1067R probably damaging Het
Other mutations in Rtcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Rtcb APN 10 85,779,793 (GRCm39) missense probably damaging 1.00
IGL02836:Rtcb APN 10 85,779,806 (GRCm39) missense possibly damaging 0.90
R0023:Rtcb UTSW 10 85,785,315 (GRCm39) unclassified probably benign
R0023:Rtcb UTSW 10 85,785,315 (GRCm39) unclassified probably benign
R0046:Rtcb UTSW 10 85,793,520 (GRCm39) missense probably benign 0.05
R0589:Rtcb UTSW 10 85,787,315 (GRCm39) missense probably damaging 0.97
R1718:Rtcb UTSW 10 85,777,881 (GRCm39) missense probably damaging 1.00
R1792:Rtcb UTSW 10 85,778,446 (GRCm39) missense probably damaging 1.00
R2011:Rtcb UTSW 10 85,777,797 (GRCm39) missense probably damaging 1.00
R2371:Rtcb UTSW 10 85,779,697 (GRCm39) missense probably benign 0.00
R3786:Rtcb UTSW 10 85,778,458 (GRCm39) missense possibly damaging 0.82
R4272:Rtcb UTSW 10 85,793,483 (GRCm39) missense probably damaging 0.99
R4926:Rtcb UTSW 10 85,791,600 (GRCm39) missense probably benign 0.00
R6272:Rtcb UTSW 10 85,791,638 (GRCm39) missense probably damaging 0.98
R6485:Rtcb UTSW 10 85,793,508 (GRCm39) missense probably benign 0.05
R6711:Rtcb UTSW 10 85,774,963 (GRCm39) missense possibly damaging 0.72
R7487:Rtcb UTSW 10 85,789,333 (GRCm39) missense probably benign 0.02
R7748:Rtcb UTSW 10 85,777,832 (GRCm39) missense probably benign 0.00
R8405:Rtcb UTSW 10 85,793,534 (GRCm39) missense probably benign 0.00
R8422:Rtcb UTSW 10 85,779,168 (GRCm39) missense probably benign
R9254:Rtcb UTSW 10 85,779,071 (GRCm39) critical splice donor site probably null
R9259:Rtcb UTSW 10 85,774,925 (GRCm39) missense probably damaging 1.00
R9379:Rtcb UTSW 10 85,779,071 (GRCm39) critical splice donor site probably null
R9749:Rtcb UTSW 10 85,785,453 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACTTGGGAAAGTCCACAGAAATC -3'
(R):5'- CATTGTAACGAGATGATCAGGACTCGC -3'

Sequencing Primer
(F):5'- CAGGAACACCGTGTCTGATG -3'
(R):5'- CGCGAAGAGTTTTGAGCCTC -3'
Posted On 2013-05-29