Incidental Mutation 'R5576:Rpp30'
ID437240
Institutional Source Beutler Lab
Gene Symbol Rpp30
Ensembl Gene ENSMUSG00000024800
Gene Nameribonuclease P/MRP 30 subunit
SynonymsTSG15, Rnasep2
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36083716-36104772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36101851 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 216 (D216E)
Ref Sequence ENSEMBL: ENSMUSP00000025714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025714]
Predicted Effect probably benign
Transcript: ENSMUST00000025714
AA Change: D216E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025714
Gene: ENSMUSG00000024800
AA Change: D216E

DomainStartEndE-ValueType
Pfam:RNase_P_p30 5 224 4.2e-66 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Rpp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0271:Rpp30 UTSW 19 36104403 missense probably benign
R1068:Rpp30 UTSW 19 36083738 start codon destroyed probably null 1.00
R1375:Rpp30 UTSW 19 36101273 critical splice donor site probably null
R1521:Rpp30 UTSW 19 36094385 missense possibly damaging 0.95
R1720:Rpp30 UTSW 19 36094427 missense probably damaging 1.00
R1872:Rpp30 UTSW 19 36087393 missense probably benign 0.03
R1965:Rpp30 UTSW 19 36089149 missense probably damaging 1.00
R1966:Rpp30 UTSW 19 36089149 missense probably damaging 1.00
R4412:Rpp30 UTSW 19 36100255 missense possibly damaging 0.95
R5633:Rpp30 UTSW 19 36086990 missense probably damaging 1.00
R6293:Rpp30 UTSW 19 36104445 makesense probably null
R7437:Rpp30 UTSW 19 36104438 missense possibly damaging 0.92
R7699:Rpp30 UTSW 19 36089158 missense probably benign 0.00
R7700:Rpp30 UTSW 19 36089158 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGGTGTTTGGATTAAGCAGC -3'
(R):5'- AGAACTGGTTGAGAAGACACCC -3'

Sequencing Primer
(F):5'- AACAGTTAATTGAGACTTCTTGGGTG -3'
(R):5'- CTGGTTGAGAAGACACCCTTATAAG -3'
Posted On2016-10-26