Incidental Mutation 'R5576:Cybb'
ID437242
Institutional Source Beutler Lab
Gene Symbol Cybb
Ensembl Gene ENSMUSG00000015340
Gene Namecytochrome b-245, beta polypeptide
Synonymsgp91phox, gp91, Cgd, Nox2
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5576 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location9435252-9487771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 9450750 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 246 (D246H)
Ref Sequence ENSEMBL: ENSMUSP00000015484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015484] [ENSMUST00000164685]
Predicted Effect probably benign
Transcript: ENSMUST00000015484
AA Change: D246H

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015484
Gene: ENSMUSG00000015340
AA Change: D246H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Ferric_reduct 54 220 8.4e-29 PFAM
Pfam:FAD_binding_6 292 395 1.6e-7 PFAM
Pfam:FAD_binding_8 292 395 1e-24 PFAM
Pfam:NAD_binding_6 401 551 5.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154503
Predicted Effect probably benign
Transcript: ENSMUST00000164685
SMART Domains Protein: ENSMUSP00000128963
Gene: ENSMUSG00000015340

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the heavy chain component of a heterodimeric transmembrane ion transporter composed of both a heavy and a light chain. This transporter mediates the transfer of electrons from nicotinamide adenine dinucleotide phosphate (NADPH) to oxygen to generate superoxide. This reaction is important in the innate immune response to pathogens. However, increased activity of the encoded protein also leads to the generation of reactive oxygen species that result in oxidative stress and can cause tissue damage. Conversely, loss of function of the related gene in human causes chronic granulomatous disease. Alternative splicing results in multiple transcript variants, although the full-length nature of some of these variants has not been determined. [provided by RefSeq, May 2013]
PHENOTYPE: Nullizygous mice show alterations in acute inflammation, synaptic plasticity, memory, metastatic potential, susceptibility to infection and induced GI injury, inflammatory response to chemical peritonitis, vascular response to Ang II, hypoxia-induced LV remodeling, and L-NAME-caused renal responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Cybb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Cybb APN X 9446744 missense possibly damaging 0.46
IGL02145:Cybb APN X 9457018 missense probably damaging 1.00
IGL02626:Cybb APN X 9469200 splice site probably null
IGL02644:Cybb APN X 9467156 missense probably benign 0.00
IGL02869:Cybb APN X 9442589 missense probably benign 0.00
IGL03145:Cybb APN X 9453653 nonsense probably null
R3978:Cybb UTSW X 9444588 missense probably damaging 1.00
R3980:Cybb UTSW X 9444588 missense probably damaging 1.00
R4758:Cybb UTSW X 9450750 missense probably benign 0.10
R4761:Cybb UTSW X 9450750 missense probably benign 0.10
R4787:Cybb UTSW X 9450750 missense probably benign 0.10
R4788:Cybb UTSW X 9450750 missense probably benign 0.10
R4793:Cybb UTSW X 9450750 missense probably benign 0.10
R4847:Cybb UTSW X 9450750 missense probably benign 0.10
R4901:Cybb UTSW X 9450750 missense probably benign 0.10
R4902:Cybb UTSW X 9450750 missense probably benign 0.10
R4904:Cybb UTSW X 9450750 missense probably benign 0.10
R4914:Cybb UTSW X 9450750 missense probably benign 0.10
R4915:Cybb UTSW X 9450750 missense probably benign 0.10
R4916:Cybb UTSW X 9450750 missense probably benign 0.10
R5058:Cybb UTSW X 9450750 missense probably benign 0.10
R5246:Cybb UTSW X 9450750 missense probably benign 0.10
R5416:Cybb UTSW X 9450750 missense probably benign 0.10
R5519:Cybb UTSW X 9450750 missense probably benign 0.10
R5538:Cybb UTSW X 9450750 missense probably benign 0.10
R5539:Cybb UTSW X 9450750 missense probably benign 0.10
R5578:Cybb UTSW X 9450750 missense probably benign 0.10
R5728:Cybb UTSW X 9450750 missense probably benign 0.10
R5729:Cybb UTSW X 9450750 missense probably benign 0.10
R5761:Cybb UTSW X 9450750 missense probably benign 0.10
R5762:Cybb UTSW X 9450750 missense probably benign 0.10
R5927:Cybb UTSW X 9450750 missense probably benign 0.10
R6057:Cybb UTSW X 9450750 missense probably benign 0.10
R6086:Cybb UTSW X 9450750 missense probably benign 0.10
R6144:Cybb UTSW X 9450750 missense probably benign 0.10
R6147:Cybb UTSW X 9450750 missense probably benign 0.10
Z1176:Cybb UTSW X 9438240 missense probably damaging 0.99
Z1176:Cybb UTSW X 9440001 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTTTCCCACATGTCCTGG -3'
(R):5'- TTTGCGATATGTGCACAATCAG -3'

Sequencing Primer
(F):5'- CTTCTCAACTTGACACATGCTAGAG -3'
(R):5'- CACAATCAGTGTTGAGGATATAGGCC -3'
Posted On2016-10-26