Incidental Mutation 'R5577:Sec31a'
ID437251
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 043132-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R5577 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100402274 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 194 (T194A)
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094578
AA Change: T194A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: T194A

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182850
Predicted Effect possibly damaging
Transcript: ENSMUST00000182886
AA Change: T194A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: T194A

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,236,654 Y256D probably damaging Het
Acr C A 15: 89,574,238 T374K probably benign Het
Akt2 G A 7: 27,636,306 G335R probably damaging Het
Cd177 A T 7: 24,745,137 F673Y probably damaging Het
Clmn G T 12: 104,777,070 S879R probably damaging Het
Csrp3 T C 7: 48,839,477 H19R possibly damaging Het
Dmkn T C 7: 30,764,546 S137P probably damaging Het
Eno1 C A 4: 150,246,610 Y236* probably null Het
Enpp7 T A 11: 118,992,127 N342K probably benign Het
Fancm T A 12: 65,130,411 probably benign Het
Fshr A T 17: 88,985,923 D442E probably benign Het
Gm3898 T A 9: 43,830,065 noncoding transcript Het
Hdac7 A T 15: 97,811,455 S43T probably benign Het
Herc1 T C 9: 66,481,981 C3927R probably damaging Het
Klc4 G T 17: 46,635,429 A490D probably damaging Het
Lcn9 T A 2: 25,823,651 I63N probably damaging Het
Lgalsl G A 11: 20,829,316 Q110* probably null Het
Lrp1b A T 2: 40,875,123 M2783K possibly damaging Het
Lrrk2 A T 15: 91,765,745 Y1695F probably damaging Het
Myo1e G A 9: 70,370,471 E817K probably benign Het
Nav3 A T 10: 109,769,403 D936E probably damaging Het
Necab3 T C 2: 154,545,156 probably null Het
Nlrp1a T A 11: 71,099,574 I951F probably damaging Het
Nov T A 15: 54,752,501 I354N possibly damaging Het
Olfr110 T A 17: 37,499,602 I317K probably benign Het
Olfr917 A G 9: 38,665,001 I281T possibly damaging Het
Ppp2r5d T C 17: 46,687,975 S54G probably benign Het
Prdx6 A G 1: 161,243,685 S146P probably damaging Het
Sec24a A T 11: 51,734,621 H258Q probably benign Het
Sqstm1 T C 11: 50,207,439 I167V probably benign Het
Tas1r3 T C 4: 155,862,065 E361G probably benign Het
Tlr1 T A 5: 64,926,085 Q383L possibly damaging Het
Trappc8 G C 18: 20,836,779 Y1051* probably null Het
Vmn2r2 T A 3: 64,116,995 M722L probably benign Het
Vmn2r43 T C 7: 8,244,812 H784R probably damaging Het
Zfp534 T G 4: 147,674,716 K499Q probably damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 unclassified probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTACAATCTTTCCACCATTAAC -3'
(R):5'- ACTGCCTAAAACCAACTGGGG -3'

Sequencing Primer
(F):5'- AGCGTACTTCCAGCAGAA -3'
(R):5'- TGGCTTACTCACGGCTTCAGG -3'
Posted On2016-10-26