Incidental Mutation 'R5577:Olfr917'
ID437258
Institutional Source Beutler Lab
Gene Symbol Olfr917
Ensembl Gene ENSMUSG00000063225
Gene Nameolfactory receptor 917
SynonymsGA_x6K02T2PVTD-32368166-32367237, MOR168-2P
MMRRC Submission 043132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5577 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38664913-38665842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38665001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 281 (I281T)
Ref Sequence ENSEMBL: ENSMUSP00000075857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076542] [ENSMUST00000215461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076542
AA Change: I281T

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075857
Gene: ENSMUSG00000063225
AA Change: I281T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-42 PFAM
Pfam:7tm_1 41 289 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213750
Predicted Effect probably benign
Transcript: ENSMUST00000215461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217596
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,236,654 Y256D probably damaging Het
Acr C A 15: 89,574,238 T374K probably benign Het
Akt2 G A 7: 27,636,306 G335R probably damaging Het
Cd177 A T 7: 24,745,137 F673Y probably damaging Het
Clmn G T 12: 104,777,070 S879R probably damaging Het
Csrp3 T C 7: 48,839,477 H19R possibly damaging Het
Dmkn T C 7: 30,764,546 S137P probably damaging Het
Eno1 C A 4: 150,246,610 Y236* probably null Het
Enpp7 T A 11: 118,992,127 N342K probably benign Het
Fancm T A 12: 65,130,411 probably benign Het
Fshr A T 17: 88,985,923 D442E probably benign Het
Gm3898 T A 9: 43,830,065 noncoding transcript Het
Hdac7 A T 15: 97,811,455 S43T probably benign Het
Herc1 T C 9: 66,481,981 C3927R probably damaging Het
Klc4 G T 17: 46,635,429 A490D probably damaging Het
Lcn9 T A 2: 25,823,651 I63N probably damaging Het
Lgalsl G A 11: 20,829,316 Q110* probably null Het
Lrp1b A T 2: 40,875,123 M2783K possibly damaging Het
Lrrk2 A T 15: 91,765,745 Y1695F probably damaging Het
Myo1e G A 9: 70,370,471 E817K probably benign Het
Nav3 A T 10: 109,769,403 D936E probably damaging Het
Necab3 T C 2: 154,545,156 probably null Het
Nlrp1a T A 11: 71,099,574 I951F probably damaging Het
Nov T A 15: 54,752,501 I354N possibly damaging Het
Olfr110 T A 17: 37,499,602 I317K probably benign Het
Ppp2r5d T C 17: 46,687,975 S54G probably benign Het
Prdx6 A G 1: 161,243,685 S146P probably damaging Het
Sec24a A T 11: 51,734,621 H258Q probably benign Het
Sec31a T C 5: 100,402,274 T194A possibly damaging Het
Sqstm1 T C 11: 50,207,439 I167V probably benign Het
Tas1r3 T C 4: 155,862,065 E361G probably benign Het
Tlr1 T A 5: 64,926,085 Q383L possibly damaging Het
Trappc8 G C 18: 20,836,779 Y1051* probably null Het
Vmn2r2 T A 3: 64,116,995 M722L probably benign Het
Vmn2r43 T C 7: 8,244,812 H784R probably damaging Het
Zfp534 T G 4: 147,674,716 K499Q probably damaging Het
Other mutations in Olfr917
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Olfr917 APN 9 38664993 missense probably benign
IGL02704:Olfr917 APN 9 38665767 missense possibly damaging 0.84
R0529:Olfr917 UTSW 9 38665512 missense probably benign 0.11
R1575:Olfr917 UTSW 9 38665277 missense probably damaging 1.00
R1681:Olfr917 UTSW 9 38665320 missense probably benign
R2941:Olfr917 UTSW 9 38665026 missense probably damaging 0.98
R3083:Olfr917 UTSW 9 38665616 missense probably damaging 0.99
R4450:Olfr917 UTSW 9 38665754 missense probably benign 0.17
R4755:Olfr917 UTSW 9 38665832 missense probably benign
R4774:Olfr917 UTSW 9 38665223 missense probably benign 0.21
R5322:Olfr917 UTSW 9 38665206 missense probably benign 0.24
R6101:Olfr917 UTSW 9 38665620 missense probably damaging 0.99
R6105:Olfr917 UTSW 9 38665620 missense probably damaging 0.99
R7084:Olfr917 UTSW 9 38665269 missense probably benign 0.04
R8048:Olfr917 UTSW 9 38665812 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGGTTCTGCTTGTTCAAAAC -3'
(R):5'- CCACACGTGTCAATGAGGTTG -3'

Sequencing Primer
(F):5'- AGACAACACTGGACAGTC -3'
(R):5'- GTTGGGAGCATCAATATCATTATTCC -3'
Posted On2016-10-26