Incidental Mutation 'R5577:Gm3898'
ID437259
Institutional Source Beutler Lab
Gene Symbol Gm3898
Ensembl Gene ENSMUSG00000096322
Gene Namepredicted gene 3898
Synonyms
MMRRC Submission 043132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5577 (G1)
Quality Score90
Status Not validated
Chromosome9
Chromosomal Location43829963-43832516 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 43830065 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180221
SMART Domains Protein: ENSMUSP00000136570
Gene: ENSMUSG00000096322

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216905
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,236,654 Y256D probably damaging Het
Acr C A 15: 89,574,238 T374K probably benign Het
Akt2 G A 7: 27,636,306 G335R probably damaging Het
Cd177 A T 7: 24,745,137 F673Y probably damaging Het
Clmn G T 12: 104,777,070 S879R probably damaging Het
Csrp3 T C 7: 48,839,477 H19R possibly damaging Het
Dmkn T C 7: 30,764,546 S137P probably damaging Het
Eno1 C A 4: 150,246,610 Y236* probably null Het
Enpp7 T A 11: 118,992,127 N342K probably benign Het
Fancm T A 12: 65,130,411 probably benign Het
Fshr A T 17: 88,985,923 D442E probably benign Het
Hdac7 A T 15: 97,811,455 S43T probably benign Het
Herc1 T C 9: 66,481,981 C3927R probably damaging Het
Klc4 G T 17: 46,635,429 A490D probably damaging Het
Lcn9 T A 2: 25,823,651 I63N probably damaging Het
Lgalsl G A 11: 20,829,316 Q110* probably null Het
Lrp1b A T 2: 40,875,123 M2783K possibly damaging Het
Lrrk2 A T 15: 91,765,745 Y1695F probably damaging Het
Myo1e G A 9: 70,370,471 E817K probably benign Het
Nav3 A T 10: 109,769,403 D936E probably damaging Het
Necab3 T C 2: 154,545,156 probably null Het
Nlrp1a T A 11: 71,099,574 I951F probably damaging Het
Nov T A 15: 54,752,501 I354N possibly damaging Het
Olfr110 T A 17: 37,499,602 I317K probably benign Het
Olfr917 A G 9: 38,665,001 I281T possibly damaging Het
Ppp2r5d T C 17: 46,687,975 S54G probably benign Het
Prdx6 A G 1: 161,243,685 S146P probably damaging Het
Sec24a A T 11: 51,734,621 H258Q probably benign Het
Sec31a T C 5: 100,402,274 T194A possibly damaging Het
Sqstm1 T C 11: 50,207,439 I167V probably benign Het
Tas1r3 T C 4: 155,862,065 E361G probably benign Het
Tlr1 T A 5: 64,926,085 Q383L possibly damaging Het
Trappc8 G C 18: 20,836,779 Y1051* probably null Het
Vmn2r2 T A 3: 64,116,995 M722L probably benign Het
Vmn2r43 T C 7: 8,244,812 H784R probably damaging Het
Zfp534 T G 4: 147,674,716 K499Q probably damaging Het
Other mutations in Gm3898
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5574:Gm3898 UTSW 9 43830042 intron noncoding transcript
R5985:Gm3898 UTSW 9 43830032 intron noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGCTAACTTTTCCTAGCTCATGAG -3'
(R):5'- TGTGCATCTCCAAATTGGGC -3'

Sequencing Primer
(F):5'- AACTTTTCCTAGCTCATGAGTCTCTC -3'
(R):5'- CTCCAAATTGGGCTGTCAAAG -3'
Posted On2016-10-26