Incidental Mutation 'R5577:Enpp7'
ID437268
Institutional Source Beutler Lab
Gene Symbol Enpp7
Ensembl Gene ENSMUSG00000046697
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 7
SynonymsLOC238011, Alk-SMase
MMRRC Submission 043132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5577 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118988188-118992841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118992127 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 342 (N342K)
Ref Sequence ENSEMBL: ENSMUSP00000090027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092373] [ENSMUST00000106273]
Predicted Effect probably benign
Transcript: ENSMUST00000092373
AA Change: N342K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000090027
Gene: ENSMUSG00000046697
AA Change: N342K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 2.5e-76 PFAM
Pfam:Metalloenzyme 43 272 8.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106273
AA Change: N342K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101880
Gene: ENSMUSG00000046697
AA Change: N342K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 3e-77 PFAM
Pfam:Metalloenzyme 41 257 5.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intestinal alkaline sphingomyelin phosphodiesterase that converts sphingomyelin to ceramide and phosphocholine. The encoded protein is anchored in the cell membrane, and it may function to protect the intestinal mucosa from inflammation and tumorigenesis. This protein is glycosylated and also exhibits lysophosphatidylcholine hydrolase activity. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit intestinal epithelium hypertrophy, decreased crypt and villi width, and impaired sphingomyelin digestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,236,654 Y256D probably damaging Het
Acr C A 15: 89,574,238 T374K probably benign Het
Akt2 G A 7: 27,636,306 G335R probably damaging Het
Cd177 A T 7: 24,745,137 F673Y probably damaging Het
Clmn G T 12: 104,777,070 S879R probably damaging Het
Csrp3 T C 7: 48,839,477 H19R possibly damaging Het
Dmkn T C 7: 30,764,546 S137P probably damaging Het
Eno1 C A 4: 150,246,610 Y236* probably null Het
Fancm T A 12: 65,130,411 probably benign Het
Fshr A T 17: 88,985,923 D442E probably benign Het
Gm3898 T A 9: 43,830,065 noncoding transcript Het
Hdac7 A T 15: 97,811,455 S43T probably benign Het
Herc1 T C 9: 66,481,981 C3927R probably damaging Het
Klc4 G T 17: 46,635,429 A490D probably damaging Het
Lcn9 T A 2: 25,823,651 I63N probably damaging Het
Lgalsl G A 11: 20,829,316 Q110* probably null Het
Lrp1b A T 2: 40,875,123 M2783K possibly damaging Het
Lrrk2 A T 15: 91,765,745 Y1695F probably damaging Het
Myo1e G A 9: 70,370,471 E817K probably benign Het
Nav3 A T 10: 109,769,403 D936E probably damaging Het
Necab3 T C 2: 154,545,156 probably null Het
Nlrp1a T A 11: 71,099,574 I951F probably damaging Het
Nov T A 15: 54,752,501 I354N possibly damaging Het
Olfr110 T A 17: 37,499,602 I317K probably benign Het
Olfr917 A G 9: 38,665,001 I281T possibly damaging Het
Ppp2r5d T C 17: 46,687,975 S54G probably benign Het
Prdx6 A G 1: 161,243,685 S146P probably damaging Het
Sec24a A T 11: 51,734,621 H258Q probably benign Het
Sec31a T C 5: 100,402,274 T194A possibly damaging Het
Sqstm1 T C 11: 50,207,439 I167V probably benign Het
Tas1r3 T C 4: 155,862,065 E361G probably benign Het
Tlr1 T A 5: 64,926,085 Q383L possibly damaging Het
Trappc8 G C 18: 20,836,779 Y1051* probably null Het
Vmn2r2 T A 3: 64,116,995 M722L probably benign Het
Vmn2r43 T C 7: 8,244,812 H784R probably damaging Het
Zfp534 T G 4: 147,674,716 K499Q probably damaging Het
Other mutations in Enpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Enpp7 APN 11 118990545 missense probably damaging 1.00
IGL02488:Enpp7 APN 11 118988814 missense probably damaging 1.00
IGL02672:Enpp7 APN 11 118992340 critical splice donor site probably null
R0465:Enpp7 UTSW 11 118988781 missense probably damaging 1.00
R1718:Enpp7 UTSW 11 118990983 missense probably damaging 1.00
R2208:Enpp7 UTSW 11 118988762 splice site probably benign
R2970:Enpp7 UTSW 11 118990646 missense probably damaging 1.00
R3713:Enpp7 UTSW 11 118990518 missense probably damaging 1.00
R3967:Enpp7 UTSW 11 118991001 missense probably damaging 0.99
R5222:Enpp7 UTSW 11 118990962 missense probably benign 0.03
R5454:Enpp7 UTSW 11 118988808 missense probably benign 0.03
R7361:Enpp7 UTSW 11 118992159 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACATTGCAAACTTTTCCTAAGGTC -3'
(R):5'- AAGTTCACAGGCGCGTACAC -3'

Sequencing Primer
(F):5'- CTAAGGTCATCTGCCAACATGGG -3'
(R):5'- GATGCCAGGATTCCCATCGTTG -3'
Posted On2016-10-26