Incidental Mutation 'R5577:Acr'
ID437272
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Nameacrosin prepropeptide
Synonymspreproacrosin
MMRRC Submission 043132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5577 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89568326-89574585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89574238 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 374 (T374K)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
Predicted Effect probably benign
Transcript: ENSMUST00000023295
AA Change: T374K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: T374K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230538
Predicted Effect probably benign
Transcript: ENSMUST00000230978
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,236,654 Y256D probably damaging Het
Akt2 G A 7: 27,636,306 G335R probably damaging Het
Cd177 A T 7: 24,745,137 F673Y probably damaging Het
Clmn G T 12: 104,777,070 S879R probably damaging Het
Csrp3 T C 7: 48,839,477 H19R possibly damaging Het
Dmkn T C 7: 30,764,546 S137P probably damaging Het
Eno1 C A 4: 150,246,610 Y236* probably null Het
Enpp7 T A 11: 118,992,127 N342K probably benign Het
Fancm T A 12: 65,130,411 probably benign Het
Fshr A T 17: 88,985,923 D442E probably benign Het
Gm3898 T A 9: 43,830,065 noncoding transcript Het
Hdac7 A T 15: 97,811,455 S43T probably benign Het
Herc1 T C 9: 66,481,981 C3927R probably damaging Het
Klc4 G T 17: 46,635,429 A490D probably damaging Het
Lcn9 T A 2: 25,823,651 I63N probably damaging Het
Lgalsl G A 11: 20,829,316 Q110* probably null Het
Lrp1b A T 2: 40,875,123 M2783K possibly damaging Het
Lrrk2 A T 15: 91,765,745 Y1695F probably damaging Het
Myo1e G A 9: 70,370,471 E817K probably benign Het
Nav3 A T 10: 109,769,403 D936E probably damaging Het
Necab3 T C 2: 154,545,156 probably null Het
Nlrp1a T A 11: 71,099,574 I951F probably damaging Het
Nov T A 15: 54,752,501 I354N possibly damaging Het
Olfr110 T A 17: 37,499,602 I317K probably benign Het
Olfr917 A G 9: 38,665,001 I281T possibly damaging Het
Ppp2r5d T C 17: 46,687,975 S54G probably benign Het
Prdx6 A G 1: 161,243,685 S146P probably damaging Het
Sec24a A T 11: 51,734,621 H258Q probably benign Het
Sec31a T C 5: 100,402,274 T194A possibly damaging Het
Sqstm1 T C 11: 50,207,439 I167V probably benign Het
Tas1r3 T C 4: 155,862,065 E361G probably benign Het
Tlr1 T A 5: 64,926,085 Q383L possibly damaging Het
Trappc8 G C 18: 20,836,779 Y1051* probably null Het
Vmn2r2 T A 3: 64,116,995 M722L probably benign Het
Vmn2r43 T C 7: 8,244,812 H784R probably damaging Het
Zfp534 T G 4: 147,674,716 K499Q probably damaging Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89573250 missense probably benign 0.19
IGL00857:Acr APN 15 89570002 missense probably benign 0.00
IGL01353:Acr APN 15 89569492 missense probably damaging 1.00
IGL01466:Acr APN 15 89573994 missense probably benign
IGL01599:Acr APN 15 89568414 missense probably benign 0.01
IGL02408:Acr APN 15 89570014 missense probably damaging 1.00
R0042:Acr UTSW 15 89574332 missense probably benign
R0398:Acr UTSW 15 89573941 missense probably damaging 1.00
R0520:Acr UTSW 15 89573227 missense probably damaging 1.00
R0578:Acr UTSW 15 89569475 missense probably damaging 1.00
R0579:Acr UTSW 15 89569475 missense probably damaging 1.00
R1167:Acr UTSW 15 89573974 missense probably damaging 1.00
R1792:Acr UTSW 15 89573143 missense probably benign 0.00
R2006:Acr UTSW 15 89574201 missense probably benign 0.00
R5531:Acr UTSW 15 89573943 missense probably damaging 1.00
R7033:Acr UTSW 15 89569500 missense probably benign 0.03
R7206:Acr UTSW 15 89574171 missense probably benign
R7484:Acr UTSW 15 89573224 missense probably damaging 0.99
R7548:Acr UTSW 15 89574393 missense possibly damaging 0.72
R8001:Acr UTSW 15 89573962 missense probably damaging 1.00
Z1177:Acr UTSW 15 89569879 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTTGATTCAGCCAGCCAC -3'
(R):5'- TTTTCTCAGGAATGGAGGAAGG -3'

Sequencing Primer
(F):5'- GACTACCCGCCATCCGATG -3'
(R):5'- TGGAGGAAGGGCTCGCTG -3'
Posted On2016-10-26