Incidental Mutation 'R5578:Arhgap40'
ID437285
Institutional Source Beutler Lab
Gene Symbol Arhgap40
Ensembl Gene ENSMUSG00000074625
Gene NameRho GTPase activating protein 40
SynonymsGm14203
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158512796-158550762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 158531206 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 128 (G128V)
Ref Sequence ENSEMBL: ENSMUSP00000130349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099133] [ENSMUST00000165398]
Predicted Effect probably damaging
Transcript: ENSMUST00000099133
AA Change: G131V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096736
Gene: ENSMUSG00000074625
AA Change: G131V

DomainStartEndE-ValueType
low complexity region 123 143 N/A INTRINSIC
RhoGAP 340 519 1.84e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165398
AA Change: G128V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130349
Gene: ENSMUSG00000074625
AA Change: G128V

DomainStartEndE-ValueType
low complexity region 120 140 N/A INTRINSIC
RhoGAP 337 516 1.84e-47 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Arhgap40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Arhgap40 APN 2 158531158 missense probably benign 0.41
IGL00547:Arhgap40 APN 2 158538626 splice site probably benign
IGL00911:Arhgap40 APN 2 158534716 splice site probably benign
IGL01084:Arhgap40 APN 2 158543218 missense probably damaging 1.00
IGL02037:Arhgap40 APN 2 158534822 missense probably damaging 1.00
IGL02111:Arhgap40 APN 2 158539844 missense probably damaging 0.99
IGL02131:Arhgap40 APN 2 158531939 splice site probably null
IGL02552:Arhgap40 APN 2 158546801 missense probably benign
PIT4305001:Arhgap40 UTSW 2 158531905 missense probably benign 0.00
R0212:Arhgap40 UTSW 2 158550575 missense probably damaging 1.00
R0508:Arhgap40 UTSW 2 158546750 missense probably damaging 1.00
R0787:Arhgap40 UTSW 2 158547790 missense probably benign
R1075:Arhgap40 UTSW 2 158549647 missense possibly damaging 0.54
R1201:Arhgap40 UTSW 2 158534769 missense probably damaging 1.00
R1511:Arhgap40 UTSW 2 158527161 missense probably benign
R1519:Arhgap40 UTSW 2 158546801 missense probably benign
R1567:Arhgap40 UTSW 2 158546799 missense probably damaging 1.00
R1662:Arhgap40 UTSW 2 158539270 missense probably damaging 1.00
R4120:Arhgap40 UTSW 2 158532330 missense probably benign 0.02
R4592:Arhgap40 UTSW 2 158546709 missense possibly damaging 0.88
R4678:Arhgap40 UTSW 2 158532306 missense probably benign 0.01
R4818:Arhgap40 UTSW 2 158539719 missense probably damaging 1.00
R4953:Arhgap40 UTSW 2 158543406 missense possibly damaging 0.57
R5108:Arhgap40 UTSW 2 158547679 missense probably damaging 1.00
R6924:Arhgap40 UTSW 2 158527146 missense probably benign 0.00
R6931:Arhgap40 UTSW 2 158531218 missense probably benign 0.00
R7028:Arhgap40 UTSW 2 158531374 critical splice donor site probably null
R7253:Arhgap40 UTSW 2 158547656 missense probably benign
R7385:Arhgap40 UTSW 2 158543227 missense probably damaging 1.00
R7670:Arhgap40 UTSW 2 158531925 missense probably benign 0.03
R7813:Arhgap40 UTSW 2 158538700 missense probably benign 0.00
R7824:Arhgap40 UTSW 2 158534746 missense probably damaging 1.00
Z1176:Arhgap40 UTSW 2 158534885 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAATGTTGTAAGCACCCC -3'
(R):5'- TACCCTTGACGTGAAGACCC -3'

Sequencing Primer
(F):5'- CATGTGCCTCAATATGAGCACTG -3'
(R):5'- CCAAAGATATCCCTGACGTCTCTG -3'
Posted On2016-10-26