Incidental Mutation 'R5578:Mab21l1'
ID437287
Institutional Source Beutler Lab
Gene Symbol Mab21l1
Ensembl Gene ENSMUSG00000056947
Gene Namemab-21-like 1 (C. elegans)
Synonyms
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location55782510-55785001 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 55784014 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 341 (Q341*)
Ref Sequence ENSEMBL: ENSMUSP00000074878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374] [ENSMUST00000075422]
Predicted Effect probably benign
Transcript: ENSMUST00000029374
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000075422
AA Change: Q341*
SMART Domains Protein: ENSMUSP00000074878
Gene: ENSMUSG00000056947
AA Change: Q341*

DomainStartEndE-ValueType
Mab-21 61 347 3.59e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199535
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the MAB-21 cell fate-determining gene found in C. elegans. It may be involved in eye and cerebellum development, and it has been proposed that expansion of a trinucleotide repeat region in the 5' UTR may play a role in a variety of psychiatric disorders. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in male infertility and eye developmental anomalies. Mutant eyes are small, absent of lens and iris, and display malformations of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Mab21l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mab21l1 APN 3 55783136 missense probably damaging 1.00
IGL01479:Mab21l1 APN 3 55783832 missense probably damaging 1.00
IGL02127:Mab21l1 APN 3 55783595 missense probably benign 0.01
IGL02707:Mab21l1 APN 3 55783084 missense possibly damaging 0.80
R1529:Mab21l1 UTSW 3 55783833 nonsense probably null
R1911:Mab21l1 UTSW 3 55783627 missense possibly damaging 0.64
R5973:Mab21l1 UTSW 3 55783112 missense probably benign 0.32
R6008:Mab21l1 UTSW 3 55783097 missense possibly damaging 0.93
R6373:Mab21l1 UTSW 3 55783084 missense possibly damaging 0.80
R7471:Mab21l1 UTSW 3 55783886 missense possibly damaging 0.95
R7779:Mab21l1 UTSW 3 55783375 missense possibly damaging 0.67
R7878:Mab21l1 UTSW 3 55784017 missense probably benign 0.18
R7961:Mab21l1 UTSW 3 55784017 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACTCTGGTGTCCTACGAGTG -3'
(R):5'- TCCCCTGTGTGAGATGATGG -3'

Sequencing Primer
(F):5'- TGTCCTACGAGTGCGAGAAG -3'
(R):5'- AAAGGAAGAGATTGTTTGCACTGTC -3'
Posted On2016-10-26