Incidental Mutation 'R0046:Adamts16'
ID43730
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Synonyms
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0046 (G1)
Quality Score193
Status Validated
Chromosome13
Chromosomal Location70727802-70841811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70763460 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 871 (S871P)
Ref Sequence ENSEMBL: ENSMUSP00000105316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
Predicted Effect probably benign
Transcript: ENSMUST00000080145
AA Change: S871P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: S871P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109694
AA Change: S871P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: S871P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70795484 missense probably benign 0.01
IGL01338:Adamts16 APN 13 70836115 missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70793141 missense probably benign 0.01
IGL01804:Adamts16 APN 13 70800961 nonsense probably null
IGL01874:Adamts16 APN 13 70768704 missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70787147 missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70772929 missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02357:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02429:Adamts16 APN 13 70787170 splice site probably benign
IGL02450:Adamts16 APN 13 70836300 missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70738778 critical splice donor site probably null
IGL03356:Adamts16 APN 13 70753291 missense probably benign 0.00
swap UTSW 13 70779518 critical splice donor site probably benign
switcheroo UTSW 13 70800954 missense probably benign
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0201:Adamts16 UTSW 13 70779644 missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70779611 missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70791794 critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70779552 missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70738955 missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70768647 missense probably benign
R0524:Adamts16 UTSW 13 70800894 missense probably benign 0.00
R0590:Adamts16 UTSW 13 70800954 missense probably benign
R0734:Adamts16 UTSW 13 70738481 splice site probably benign
R0787:Adamts16 UTSW 13 70738829 missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70768692 missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70763561 splice site probably benign
R1027:Adamts16 UTSW 13 70767802 missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1535:Adamts16 UTSW 13 70791794 critical splice donor site probably null
R1617:Adamts16 UTSW 13 70798035 missense probably benign 0.09
R1700:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70779598 synonymous probably null
R1869:Adamts16 UTSW 13 70735747 missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70791886 missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70753267 missense probably benign 0.39
R2018:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70801007 missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3411:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3842:Adamts16 UTSW 13 70738891 missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70767992 missense probably benign 0.01
R4435:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70779624 missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70753196 nonsense probably null
R5464:Adamts16 UTSW 13 70761749 missense probably benign 0.01
R5613:Adamts16 UTSW 13 70730134 missense probably benign 0.01
R5667:Adamts16 UTSW 13 70836375 nonsense probably null
R5735:Adamts16 UTSW 13 70836218 missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70738498 missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70728910 missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70770274 nonsense probably null
R6351:Adamts16 UTSW 13 70836203 missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70779570 missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70728898 missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70768520 intron probably null
R6996:Adamts16 UTSW 13 70798038 critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70772955 nonsense probably null
R7356:Adamts16 UTSW 13 70836280 missense probably benign 0.03
R7509:Adamts16 UTSW 13 70787164 missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70730115 missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70836146 missense probably damaging 0.97
Z1176:Adamts16 UTSW 13 70761773 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGTGGATCTGAGTATACAAGGGGA -3'
(R):5'- CCTCTACAAGTGCTGCTGATGGC -3'

Sequencing Primer
(F):5'- CAAGGGGATGGCAAATTATTTTACAG -3'
(R):5'- GGCCAAGTCAAGCTTCAGC -3'
Posted On2013-05-29