Incidental Mutation 'R5578:S1pr5'
ID437305
Institutional Source Beutler Lab
Gene Symbol S1pr5
Ensembl Gene ENSMUSG00000045087
Gene Namesphingosine-1-phosphate receptor 5
SynonymsS1P5, Edg8, lpB4
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R5578 (G1)
Quality Score162
Status Not validated
Chromosome9
Chromosomal Location21242912-21248443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21244551 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 193 (Y193F)
Ref Sequence ENSEMBL: ENSMUSP00000113843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122088]
Predicted Effect probably damaging
Transcript: ENSMUST00000122088
AA Change: Y193F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113843
Gene: ENSMUSG00000045087
AA Change: Y193F

DomainStartEndE-ValueType
Pfam:7tm_1 53 307 9.6e-37 PFAM
low complexity region 318 327 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215491
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lysosphingolipid sphingosine 1-phosphate (S1P) regulates cell proliferation, apoptosis, motility, and neurite retraction. Its actions may be both intracellular as a second messenger and extracellular as a receptor ligand. S1P and the structurally related lysolipid mediator lysophosphatidic acid (LPA) signal cells through a set of G protein-coupled receptors known as EDG receptors. Some EDG receptors (e.g., EDG1; MIM 601974) are S1P receptors; others (e.g., EDG2; MIM 602282) are LPA receptors.[supplied by OMIM, Mar 2008]
PHENOTYPE: Bone marrow from mice homozygous for a knock-out allele induces impaired NK cell egression from the lymph nodes and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in S1pr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:S1pr5 APN 9 21244216 missense possibly damaging 0.55
IGL01719:S1pr5 APN 9 21243954 missense probably benign 0.03
sipho UTSW 9 21244129 missense probably benign 0.01
R0392:S1pr5 UTSW 9 21244981 missense probably damaging 1.00
R0448:S1pr5 UTSW 9 21244207 missense probably damaging 1.00
R1599:S1pr5 UTSW 9 21243934 missense probably benign 0.02
R1703:S1pr5 UTSW 9 21244050 missense possibly damaging 0.52
R1850:S1pr5 UTSW 9 21244129 missense probably benign 0.01
R2095:S1pr5 UTSW 9 21244858 missense probably benign 0.04
R2178:S1pr5 UTSW 9 21244464 missense probably benign 0.36
R3082:S1pr5 UTSW 9 21244990 missense probably damaging 1.00
R3430:S1pr5 UTSW 9 21245082 missense probably benign 0.00
R7444:S1pr5 UTSW 9 21245082 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACGCGACATCCAGTAATAGC -3'
(R):5'- TTTAGAGCGCCACCTTACC -3'

Sequencing Primer
(F):5'- CCACGCTAAGGGTACGAAGC -3'
(R):5'- TTACCATGGCCCGTCGTG -3'
Posted On2016-10-26