Incidental Mutation 'R0046:Olfr742'
ID43731
Institutional Source Beutler Lab
Gene Symbol Olfr742
Ensembl Gene ENSMUSG00000068431
Gene Nameolfactory receptor 742
SynonymsGA_x6K02T2PMLR-6224293-6225228, MOR106-6
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50503600-50517145 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 50516139 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 312 (*312K)
Ref Sequence ENSEMBL: ENSMUSP00000150814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089836] [ENSMUST00000213935] [ENSMUST00000217437]
Predicted Effect probably null
Transcript: ENSMUST00000089836
AA Change: *312K
SMART Domains Protein: ENSMUSP00000087273
Gene: ENSMUSG00000068431
AA Change: *312K

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.9e-55 PFAM
Pfam:7tm_1 45 294 1.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213935
AA Change: *312K
Predicted Effect probably null
Transcript: ENSMUST00000217437
AA Change: *312K
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Olfr742
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Olfr742 APN 14 50515443 missense probably damaging 0.97
R0369:Olfr742 UTSW 14 50515825 missense probably benign 0.00
R0612:Olfr742 UTSW 14 50515482 missense probably benign
R1588:Olfr742 UTSW 14 50516127 missense probably benign
R1726:Olfr742 UTSW 14 50516179 utr 3 prime probably null
R1998:Olfr742 UTSW 14 50515356 missense probably benign 0.00
R2875:Olfr742 UTSW 14 50515812 missense probably benign 0.06
R4009:Olfr742 UTSW 14 50515962 missense possibly damaging 0.77
R5119:Olfr742 UTSW 14 50515509 missense probably benign 0.00
R5232:Olfr742 UTSW 14 50516038 missense probably damaging 0.99
R5627:Olfr742 UTSW 14 50515800 missense probably benign
R5930:Olfr742 UTSW 14 50515792 missense probably benign
R6597:Olfr742 UTSW 14 50515551 missense probably benign 0.11
R7441:Olfr742 UTSW 14 50515396 missense probably damaging 1.00
R7596:Olfr742 UTSW 14 50515545 missense probably benign 0.14
R8051:Olfr742 UTSW 14 50515643 missense probably benign 0.00
Z1088:Olfr742 UTSW 14 50515527 missense possibly damaging 0.90
Z1176:Olfr742 UTSW 14 50516065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGCACCTCTGCAACATC -3'
(R):5'- aatgccacaacacaattcttttCGTTGA -3'

Sequencing Primer
(F):5'- GGTCCAGAATTATAGACCACTTCCTG -3'
(R):5'- GTGTATGTACTAGGGTAGTA -3'
Posted On2013-05-29