Incidental Mutation 'R5578:Mdm2'
ID437310
Institutional Source Beutler Lab
Gene Symbol Mdm2
Ensembl Gene ENSMUSG00000020184
Gene Nametransformed mouse 3T3 cell double minute 2
SynonymsMdm-2, 1700007J15Rik
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117688875-117710758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117702287 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 69 (E69K)
Ref Sequence ENSEMBL: ENSMUSP00000137039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020408] [ENSMUST00000105263] [ENSMUST00000155285]
Predicted Effect probably benign
Transcript: ENSMUST00000020408
AA Change: E69K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020408
Gene: ENSMUSG00000020184
AA Change: E69K

DomainStartEndE-ValueType
Pfam:SWIB 26 101 1.3e-11 PFAM
low complexity region 145 166 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:zf-RanBP 297 326 1.7e-10 PFAM
low complexity region 390 410 N/A INTRINSIC
RING 436 476 2.42e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105263
AA Change: E20K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000100898
Gene: ENSMUSG00000020184
AA Change: E20K

DomainStartEndE-ValueType
Pfam:SWIB 1 53 5e-15 PFAM
low complexity region 96 117 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
Pfam:zf-RanBP 248 277 5.7e-10 PFAM
low complexity region 341 361 N/A INTRINSIC
RING 387 427 2.42e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147823
Predicted Effect possibly damaging
Transcript: ENSMUST00000155285
AA Change: E69K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137039
Gene: ENSMUSG00000020184
AA Change: E69K

DomainStartEndE-ValueType
Pfam:SWIB 27 102 3.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice homozygous for a null allele exhibit prenatal lethality. Mice homozygous for one knock-in allele exhibit embryonic lethality while mice homozygous for a different knock-in allele exhibit alters cell cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Mdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Mdm2 APN 10 117702299 missense possibly damaging 0.91
IGL02102:Mdm2 APN 10 117692717 missense possibly damaging 0.93
Xi-an UTSW 10 117709789 splice site probably null
PIT1430001:Mdm2 UTSW 10 117694935 missense probably damaging 1.00
R0322:Mdm2 UTSW 10 117702204 missense possibly damaging 0.78
R1589:Mdm2 UTSW 10 117690529 missense probably benign 0.01
R1766:Mdm2 UTSW 10 117696022 missense probably damaging 1.00
R3153:Mdm2 UTSW 10 117709713 missense possibly damaging 0.90
R4384:Mdm2 UTSW 10 117696439 missense possibly damaging 0.67
R4411:Mdm2 UTSW 10 117709789 splice site probably null
R5111:Mdm2 UTSW 10 117691221 missense possibly damaging 0.94
R5509:Mdm2 UTSW 10 117690612 missense probably damaging 1.00
R5727:Mdm2 UTSW 10 117702307 missense possibly damaging 0.77
R6382:Mdm2 UTSW 10 117692721 missense probably benign 0.31
R7506:Mdm2 UTSW 10 117690691 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCCAGCTGGTACTTCTTTAAG -3'
(R):5'- GCTTCTACAATACAACTGTTTGGTC -3'

Sequencing Primer
(F):5'- GTACCAACAGTTGTAAGCTGCCATG -3'
(R):5'- ACAACTGTTTGGTCTTGTACATG -3'
Posted On2016-10-26