Incidental Mutation 'R5578:Fstl4'
ID437311
Institutional Source Beutler Lab
Gene Symbol Fstl4
Ensembl Gene ENSMUSG00000036264
Gene Namefollistatin-like 4
SynonymsSPIG1, B230374F23Rik
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location52764634-53188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53165781 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 455 (V455D)
Ref Sequence ENSEMBL: ENSMUSP00000042007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036796]
Predicted Effect probably damaging
Transcript: ENSMUST00000036796
AA Change: V455D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042007
Gene: ENSMUSG00000036264
AA Change: V455D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 87 132 4.7e-13 SMART
Blast:IG_like 215 241 6e-7 BLAST
IGc2 260 327 1.9e-6 SMART
IGc2 352 419 1e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice were born at expected Mendelian ratio and healthy, fertile, apparently normal with normal retinal laminar structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Fstl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fstl4 APN 11 53186275 missense probably benign 0.01
IGL00885:Fstl4 APN 11 53148982 missense possibly damaging 0.90
IGL00915:Fstl4 APN 11 53176998 missense probably benign
IGL00933:Fstl4 APN 11 53186761 missense possibly damaging 0.80
IGL01022:Fstl4 APN 11 53186741 missense probably benign 0.18
IGL01121:Fstl4 APN 11 52814637 missense probably benign 0.00
IGL01656:Fstl4 APN 11 53000374 missense probably damaging 1.00
IGL01805:Fstl4 APN 11 53186357 missense probably damaging 1.00
IGL01997:Fstl4 APN 11 53163054 nonsense probably null
IGL02386:Fstl4 APN 11 52773871 missense probably benign 0.21
IGL02536:Fstl4 APN 11 53134024 splice site probably benign
IGL02807:Fstl4 APN 11 53186674 missense probably benign 0.03
IGL03037:Fstl4 APN 11 53168223 missense possibly damaging 0.83
R0462:Fstl4 UTSW 11 53186402 missense probably benign 0.09
R1190:Fstl4 UTSW 11 53068546 missense probably benign
R1300:Fstl4 UTSW 11 53068627 missense probably benign
R1626:Fstl4 UTSW 11 53000290 nonsense probably null
R1695:Fstl4 UTSW 11 53165878 splice site probably null
R1699:Fstl4 UTSW 11 53168178 missense possibly damaging 0.81
R1727:Fstl4 UTSW 11 53068651 missense probably damaging 1.00
R1752:Fstl4 UTSW 11 53186795 missense probably benign 0.09
R1866:Fstl4 UTSW 11 53186398 missense probably benign 0.00
R4689:Fstl4 UTSW 11 53068650 nonsense probably null
R5126:Fstl4 UTSW 11 53186561 missense possibly damaging 0.71
R5129:Fstl4 UTSW 11 53186439 missense probably damaging 1.00
R5499:Fstl4 UTSW 11 53068547 missense probably benign 0.01
R5715:Fstl4 UTSW 11 53000416 missense possibly damaging 0.53
R6125:Fstl4 UTSW 11 53186303 missense probably benign
R6177:Fstl4 UTSW 11 53168204 missense probably benign 0.00
R6236:Fstl4 UTSW 11 53186335 missense probably benign 0.00
R6311:Fstl4 UTSW 11 53176977 missense probably damaging 1.00
R6611:Fstl4 UTSW 11 53186725 missense probably benign 0.01
R6886:Fstl4 UTSW 11 53186450 missense probably damaging 1.00
R7404:Fstl4 UTSW 11 53134071 missense probably benign 0.03
R7423:Fstl4 UTSW 11 53068555 missense possibly damaging 0.54
R7586:Fstl4 UTSW 11 53072429 missense probably benign 0.00
X0013:Fstl4 UTSW 11 53162619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTTGCAAAGCTGGTGATAG -3'
(R):5'- GAGCTGAAGGAACCCAGACTTG -3'

Sequencing Primer
(F):5'- TGATAGGTTATGTTGGTTCCAAAC -3'
(R):5'- GAAGGAACCCAGACTTGCACAC -3'
Posted On2016-10-26