Incidental Mutation 'R5578:Acap2'
ID437318
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 2
SynonymsCentb2, 9530039J15Rik
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location31092412-31201245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31108114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 521 (S521P)
Ref Sequence ENSEMBL: ENSMUSP00000156077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
Predicted Effect probably benign
Transcript: ENSMUST00000058033
AA Change: S503P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076
AA Change: S503P

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229010
AA Change: S521P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000230614
AA Change: S521P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably benign
Transcript: ENSMUST00000231125
AA Change: S528P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1251:Acap2 UTSW 16 31108171 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7262:Acap2 UTSW 16 31127319 critical splice donor site probably null
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7514:Acap2 UTSW 16 31154567 splice site probably null
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R7958:Acap2 UTSW 16 31139641 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACAGAAGGAAATAGGCTTC -3'
(R):5'- CAGGTCTTCTGGTAACTGCTG -3'

Sequencing Primer
(F):5'- AGGCTTCTAGTATTTACAAAACCAC -3'
(R):5'- CTGGTAACTGCTGGGCCATTC -3'
Posted On2016-10-26