Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Rnf17'

43732

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

MMRRC Submission

038340-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.644) question?

Stock #

R0046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56402581-56525032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56471373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 750 (L750P)

Ref Sequence

ENSEMBL: ENSMUSP00000093469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793]

AlphaFold

Q99MV7

Predicted Effect

probably damaging
Transcript: ENSMUST00000095793
AA Change: L750P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: L750P

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225621

Meta Mutation Damage Score

0.3748

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Card11	T	C	5: 140,908,524	T117A	possibly damaging	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pik3c2a	A	T	7: 116,354,072	I1196N	probably damaging	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sis	T	G	3: 72,932,094	N813T	probably benign	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Stag3	C	T	5: 138,283,023		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56421082	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56465750	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56512271	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56463064	nonsense	probably null
IGL01779:Rnf17	APN	14	56462063	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56421166	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56507868	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56500587	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56482135	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56434371	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56427946	missense	possibly damaging	0.74
divest	UTSW	14	56424542	frame shift	probably null
Shed	UTSW	14	56512296	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56514106	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56482193	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56482084	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56438609	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56514175	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56522550	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56475447	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56514165	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56425631	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56467706	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56427979	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56467786	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56493365	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56522399	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56504007	nonsense	probably null
R2015:Rnf17	UTSW	14	56486969	missense	probably benign	0.00
R2023:Rnf17	UTSW	14	56431579	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56483380	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56493354	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56505982	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56500547	missense	probably damaging	1.00
R3611:Rnf17	UTSW	14	56467740	missense	probably benign	0.43
R3847:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56434355	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56522391	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5069:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56482133	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56486952	splice site	probably null
R5712:Rnf17	UTSW	14	56471399	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56465819	critical splice donor site	probably null
R5869:Rnf17	UTSW	14	56505988	missense	possibly damaging	0.94
R6336:Rnf17	UTSW	14	56421169	splice site	probably null
R6626:Rnf17	UTSW	14	56427924	missense	possibly damaging	0.92
R6639:Rnf17	UTSW	14	56438743	missense	probably benign	0.01
R6675:Rnf17	UTSW	14	56459975	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56524350	missense	possibly damaging	0.93
R7062:Rnf17	UTSW	14	56465654	missense	probably benign	0.00
R7103:Rnf17	UTSW	14	56471306	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56512332	splice site	probably null
R7527:Rnf17	UTSW	14	56516438	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56438878	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56462072	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56477687	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56487022	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56421136	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56467722	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56424542	frame shift	probably null
R8321:Rnf17	UTSW	14	56424542	frame shift	probably null
R8379:Rnf17	UTSW	14	56424542	frame shift	probably null
R8380:Rnf17	UTSW	14	56424542	frame shift	probably null
R8381:Rnf17	UTSW	14	56424542	frame shift	probably null
R8382:Rnf17	UTSW	14	56424542	frame shift	probably null
R8383:Rnf17	UTSW	14	56424542	frame shift	probably null
R8799:Rnf17	UTSW	14	56500429	missense	probably damaging	1.00
R8850:Rnf17	UTSW	14	56485201	missense	probably damaging	1.00
R9212:Rnf17	UTSW	14	56524328	missense	probably damaging	1.00
R9276:Rnf17	UTSW	14	56482097	missense	probably damaging	1.00
R9300:Rnf17	UTSW	14	56460038	missense	possibly damaging	0.79
R9375:Rnf17	UTSW	14	56482122	missense	probably damaging	1.00
R9664:Rnf17	UTSW	14	56485179	missense	probably damaging	1.00
Z1177:Rnf17	UTSW	14	56467706	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- AAAAGAGGGCTGTGCTAGTTTGTAGAG -3'
(R):5'- GGGAGCAGATAACACCTCCGTGA -3'

Sequencing Primer
(F):5'- acatacatacatacaagcaacatacc -3'
(R):5'- AGATAACACCTCCGTGATTTGC -3'

Posted On

2013-05-29