Incidental Mutation 'R5578:Mpp7'
ID 437321
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 5430426E14Rik, 1110068J02Rik
MMRRC Submission 043133-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5578 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 7347959-7626866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7355101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 442 (N442D)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000115869
AA Change: N442D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: N442D

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 30,926,932 (GRCm39) S521P probably benign Het
Aqp11 A G 7: 97,386,665 (GRCm39) F177S probably damaging Het
Arhgap40 G T 2: 158,373,126 (GRCm39) G128V probably damaging Het
Aspm A T 1: 139,398,455 (GRCm39) K1011I probably damaging Het
Cachd1 A G 4: 100,722,203 (GRCm39) T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,109,067 (GRCm39) probably benign Het
Cfhr2 A T 1: 139,758,806 (GRCm39) C81* probably null Het
Chd7 A G 4: 8,847,149 (GRCm39) T1631A probably benign Het
Clca4b T A 3: 144,638,196 (GRCm39) D22V probably benign Het
Csnk2a1-ps3 A G 1: 156,352,800 (GRCm39) M334V probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyp39a1 T A 17: 43,991,031 (GRCm39) N113K possibly damaging Het
Dnah11 A T 12: 117,982,537 (GRCm39) V2544D probably damaging Het
Dnai3 A T 3: 145,802,983 (GRCm39) Y69* probably null Het
Esr1 A C 10: 4,919,164 (GRCm39) Q418P probably damaging Het
Fam89a T A 8: 125,467,968 (GRCm39) K115* probably null Het
Fstl4 T A 11: 53,056,608 (GRCm39) V455D probably damaging Het
Gm20730 T A 6: 43,058,474 (GRCm39) M113L probably benign Het
H2ac21 T C 3: 96,127,554 (GRCm39) V108A probably damaging Het
Hk3 C T 13: 55,159,994 (GRCm39) V327M probably damaging Het
Itm2c T A 1: 85,830,774 (GRCm39) V57E possibly damaging Het
Lrba T C 3: 86,664,814 (GRCm39) Y565H probably benign Het
Mab21l1 C T 3: 55,691,435 (GRCm39) Q341* probably null Het
Mdm2 C T 10: 117,538,192 (GRCm39) E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 (GRCm39) I2709F probably benign Het
Ncoa3 A G 2: 165,896,248 (GRCm39) I384V probably benign Het
Pm20d1 A G 1: 131,743,760 (GRCm39) N475S probably benign Het
Rhpn2 A G 7: 35,070,135 (GRCm39) D131G probably damaging Het
S1pr5 T A 9: 21,155,847 (GRCm39) Y193F probably damaging Het
Sdk1 A T 5: 141,598,880 (GRCm39) K182* probably null Het
Slx4 T A 16: 3,804,726 (GRCm39) E696V probably damaging Het
Smyd4 C T 11: 75,295,602 (GRCm39) P753S probably benign Het
Stambp T G 6: 83,538,782 (GRCm39) D206A probably benign Het
Sult5a1 G T 8: 123,869,860 (GRCm39) Y262* probably null Het
Taar1 A T 10: 23,796,718 (GRCm39) I139F possibly damaging Het
Tchh A T 3: 93,351,618 (GRCm39) R353* probably null Het
Thnsl2 C T 6: 71,115,749 (GRCm39) V153I probably benign Het
Trmt5 C T 12: 73,331,837 (GRCm39) probably null Het
Trpa1 T A 1: 14,957,232 (GRCm39) Y728F probably damaging Het
Usp19 T C 9: 108,370,639 (GRCm39) V126A probably benign Het
Vcan A G 13: 89,839,622 (GRCm39) V1974A probably benign Het
Vmn2r120 T A 17: 57,829,514 (GRCm39) H461L probably benign Het
Zfp445 T C 9: 122,682,402 (GRCm39) Y513C probably benign Het
Zfp84 A C 7: 29,474,856 (GRCm39) M43L possibly damaging Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7,353,297 (GRCm39) missense probably benign 0.00
IGL01575:Mpp7 APN 18 7,403,365 (GRCm39) splice site probably benign
IGL02973:Mpp7 APN 18 7,403,297 (GRCm39) missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7,461,637 (GRCm39) critical splice donor site probably null
IGL03224:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
IGL03248:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
R0040:Mpp7 UTSW 18 7,403,180 (GRCm39) splice site probably benign
R0089:Mpp7 UTSW 18 7,439,555 (GRCm39) splice site probably benign
R1413:Mpp7 UTSW 18 7,350,977 (GRCm39) missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7,350,984 (GRCm39) missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7,350,967 (GRCm39) makesense probably null
R2379:Mpp7 UTSW 18 7,403,345 (GRCm39) nonsense probably null
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7,351,085 (GRCm39) missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7,444,062 (GRCm39) missense probably benign 0.23
R4574:Mpp7 UTSW 18 7,353,228 (GRCm39) missense probably benign 0.02
R4772:Mpp7 UTSW 18 7,379,983 (GRCm39) splice site probably null
R5066:Mpp7 UTSW 18 7,513,002 (GRCm39) missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7,458,930 (GRCm39) critical splice donor site probably null
R5451:Mpp7 UTSW 18 7,442,855 (GRCm39) missense probably null 0.95
R5651:Mpp7 UTSW 18 7,355,016 (GRCm39) critical splice donor site probably null
R5787:Mpp7 UTSW 18 7,461,682 (GRCm39) missense probably benign
R6979:Mpp7 UTSW 18 7,355,049 (GRCm39) missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7,441,623 (GRCm39) missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7,351,079 (GRCm39) missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7,440,183 (GRCm39) nonsense probably null
R8278:Mpp7 UTSW 18 7,444,025 (GRCm39) missense probably benign
R8373:Mpp7 UTSW 18 7,444,096 (GRCm39) missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7,440,430 (GRCm39) critical splice donor site probably null
R9206:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9208:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9439:Mpp7 UTSW 18 7,461,692 (GRCm39) nonsense probably null
R9790:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
R9791:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
X0028:Mpp7 UTSW 18 7,403,273 (GRCm39) missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7,355,062 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCAGACTTCATATGGAGCTC -3'
(R):5'- TTAGCACTCCGTAGCACCAAAG -3'

Sequencing Primer
(F):5'- CATGCTGAGATGCTGGAGG -3'
(R):5'- ATTGACATTTGCCGAAGTGC -3'
Posted On 2016-10-26