Mutagenetix > Incidental Mutation

Incidental Mutation 'R5578:Mpp7'

437321

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

043133-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R5578 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7355101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 442 (N442D)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000115869
AA Change: N442D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: N442D

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	A	G	16: 31,108,114	S521P	probably benign	Het
Aqp11	A	G	7: 97,737,458	F177S	probably damaging	Het
Arhgap40	G	T	2: 158,531,206	G128V	probably damaging	Het
Aspm	A	T	1: 139,470,717	K1011I	probably damaging	Het
Cachd1	A	G	4: 100,865,006	T89A	probably benign	Het
Cep89	ACTCCTCCTCCTCCTCCTCCTCCTC	ACTCCTCCTCCTCCTCCTCCTC	7: 35,409,642		probably benign	Het
Cfhr2	A	T	1: 139,831,068	C81*	probably null	Het
Chd7	A	G	4: 8,847,149	T1631A	probably benign	Het
Clca4b	T	A	3: 144,932,435	D22V	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp39a1	T	A	17: 43,680,140	N113K	possibly damaging	Het
Dnah11	A	T	12: 118,018,802	V2544D	probably damaging	Het
Esr1	A	C	10: 4,969,164	Q418P	probably damaging	Het
Fam89a	T	A	8: 124,741,229	K115*	probably null	Het
Fstl4	T	A	11: 53,165,781	V455D	probably damaging	Het
Gm10031	A	G	1: 156,525,230	M334V	probably benign	Het
Gm20730	T	A	6: 43,081,540	M113L	probably benign	Het
Hist2h2ab	T	C	3: 96,220,238	V108A	probably damaging	Het
Hk3	C	T	13: 55,012,181	V327M	probably damaging	Het
Itm2c	T	A	1: 85,903,053	V57E	possibly damaging	Het
Lrba	T	C	3: 86,757,507	Y565H	probably benign	Het
Mab21l1	C	T	3: 55,784,014	Q341*	probably null	Het
Mdm2	C	T	10: 117,702,287	E69K	possibly damaging	Het
Mdn1	A	T	4: 32,728,167	I2709F	probably benign	Het
Ncoa3	A	G	2: 166,054,328	I384V	probably benign	Het
Pm20d1	A	G	1: 131,816,022	N475S	probably benign	Het
Rhpn2	A	G	7: 35,370,710	D131G	probably damaging	Het
S1pr5	T	A	9: 21,244,551	Y193F	probably damaging	Het
Sdk1	A	T	5: 141,613,125	K182*	probably null	Het
Slx4	T	A	16: 3,986,862	E696V	probably damaging	Het
Smyd4	C	T	11: 75,404,776	P753S	probably benign	Het
Stambp	T	G	6: 83,561,800	D206A	probably benign	Het
Sult5a1	G	T	8: 123,143,121	Y262*	probably null	Het
Taar1	A	T	10: 23,920,820	I139F	possibly damaging	Het
Tchh	A	T	3: 93,444,311	R353*	probably null	Het
Thnsl2	C	T	6: 71,138,765	V153I	probably benign	Het
Trmt5	C	T	12: 73,285,063		probably null	Het
Trpa1	T	A	1: 14,887,008	Y728F	probably damaging	Het
Usp19	T	C	9: 108,493,440	V126A	probably benign	Het
Vcan	A	G	13: 89,691,503	V1974A	probably benign	Het
Vmn2r120	T	A	17: 57,522,514	H461L	probably benign	Het
Wdr63	A	T	3: 146,097,228	Y69*	probably null	Het
Zfp445	T	C	9: 122,853,337	Y513C	probably benign	Het
Zfp84	A	C	7: 29,775,431	M43L	possibly damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGCAGACTTCATATGGAGCTC -3'
(R):5'- TTAGCACTCCGTAGCACCAAAG -3'

Sequencing Primer
(F):5'- CATGCTGAGATGCTGGAGG -3'
(R):5'- ATTGACATTTGCCGAAGTGC -3'

Posted On

2016-10-26