Incidental Mutation 'R5589:Kif26b'
ID437324
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission 043142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5589 (G1)
Quality Score174
Status Not validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178916299 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 873 (V873A)
Ref Sequence ENSEMBL: ENSMUSP00000124608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably benign
Transcript: ENSMUST00000160789
AA Change: V873A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: V873A

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161017
AA Change: V1320A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: V1320A

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162545
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Ano3 A T 2: 110,884,995 S33T probably damaging Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Cckbr T C 7: 105,434,525 V220A probably damaging Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mib1 A G 18: 10,794,488 N658S probably benign Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Rrbp1 T C 2: 143,989,966 I94V probably benign Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Sostdc1 C T 12: 36,317,247 Q141* probably null Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn1r215 A C 13: 23,076,019 L76F probably damaging Het
Vmn1r215 G T 13: 23,076,020 G77C probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCATCACGCAGTTCCTG -3'
(R):5'- TCAGGCTCTTGCACGTTTCG -3'

Sequencing Primer
(F):5'- TGCCTCTCCCAAAGCTGG -3'
(R):5'- GATGTACCCTTCGCAGCTG -3'
Posted On2016-10-26