Incidental Mutation 'R5589:Or4b1b'
ID 437329
Institutional Source Beutler Lab
Gene Symbol Or4b1b
Ensembl Gene ENSMUSG00000075061
Gene Name olfactory receptor family 4 subfamily B member 1B
Synonyms Olfr1272, GA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 043142-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R5589 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 90111991-90112917 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90112313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 202 (G202D)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
AlphaFold Q8VGN8
Predicted Effect probably damaging
Transcript: ENSMUST00000099750
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: G202D

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117141
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,468,066 (GRCm39) M76L probably benign Het
Adrm1b T A 3: 92,336,112 (GRCm39) probably benign Het
Alg1 T A 16: 5,053,086 (GRCm39) W116R probably benign Het
Ano3 A T 2: 110,715,340 (GRCm39) S33T probably damaging Het
Atp2b2 T C 6: 113,751,400 (GRCm39) E556G possibly damaging Het
Brca2 T A 5: 150,480,597 (GRCm39) I2761K possibly damaging Het
Ccdc68 G A 18: 70,079,577 (GRCm39) G141E probably benign Het
Cckbr T C 7: 105,083,732 (GRCm39) V220A probably damaging Het
Ccnd3 G A 17: 47,909,544 (GRCm39) R45Q probably damaging Het
Cdh24 G T 14: 54,874,832 (GRCm39) T391N probably damaging Het
Cldn11 A G 3: 31,204,395 (GRCm39) T33A probably damaging Het
Clec2e T A 6: 129,075,391 (GRCm39) Y50F probably benign Het
Cntnap1 A G 11: 101,075,944 (GRCm39) N943D probably benign Het
Cspg4b A G 13: 113,454,484 (GRCm39) R177G possibly damaging Het
Dmgdh T C 13: 93,813,665 (GRCm39) V70A probably damaging Het
Gm14496 C A 2: 181,637,674 (GRCm39) Y249* probably null Het
Gmnc T A 16: 26,781,714 (GRCm39) H105L probably damaging Het
Gpt2 A G 8: 86,219,740 (GRCm39) Y62C probably damaging Het
Ift80 T C 3: 68,838,233 (GRCm39) R413G probably damaging Het
Kctd16 C A 18: 40,392,061 (GRCm39) D216E probably damaging Het
Kif26b T C 1: 178,743,864 (GRCm39) V873A probably benign Het
Klra4 G T 6: 130,039,117 (GRCm39) Q92K probably benign Het
L1td1 C A 4: 98,626,341 (GRCm39) N845K possibly damaging Het
Lama3 C T 18: 12,605,277 (GRCm39) T1077I possibly damaging Het
Loxhd1 T C 18: 77,429,751 (GRCm39) I230T possibly damaging Het
Lsg1 T C 16: 30,399,819 (GRCm39) N160S probably damaging Het
Lyzl4 G A 9: 121,413,469 (GRCm39) R24C probably damaging Het
Mib1 A G 18: 10,794,488 (GRCm39) N658S probably benign Het
Mmp8 T C 9: 7,566,275 (GRCm39) I377T probably damaging Het
Mtmr14 T C 6: 113,238,243 (GRCm39) probably null Het
Myo1c A G 11: 75,548,414 (GRCm39) T58A possibly damaging Het
Myo9a C T 9: 59,802,527 (GRCm39) Q2005* probably null Het
Neu3 G T 7: 99,472,636 (GRCm39) P34T probably benign Het
Nlrp4b G A 7: 10,449,512 (GRCm39) V205I probably benign Het
Or4k38 T C 2: 111,165,850 (GRCm39) N191S possibly damaging Het
Or5h23 A T 16: 58,906,334 (GRCm39) S171T probably benign Het
Or5t15 A G 2: 86,681,118 (GRCm39) I308T unknown Het
Or6c66 T G 10: 129,461,319 (GRCm39) T204P probably damaging Het
Or9m1 T C 2: 87,733,691 (GRCm39) T110A probably benign Het
Pcsk6 T C 7: 65,578,933 (GRCm39) probably null Het
Pik3c2a A G 7: 116,016,893 (GRCm39) V288A probably benign Het
Plcd3 T C 11: 102,968,629 (GRCm39) D354G probably benign Het
Prkdc C A 16: 15,524,655 (GRCm39) N1219K probably benign Het
Prl3d1 T A 13: 27,278,927 (GRCm39) Y41N probably damaging Het
Qrich2 C T 11: 116,332,234 (GRCm39) G2321R probably damaging Het
Rrbp1 T C 2: 143,831,886 (GRCm39) I94V probably benign Het
Serinc1 C A 10: 57,399,262 (GRCm39) V214L probably benign Het
Serpina9 G T 12: 103,967,728 (GRCm39) N222K probably benign Het
Smchd1 A G 17: 71,747,956 (GRCm39) Y429H probably damaging Het
Smyd1 C T 6: 71,239,164 (GRCm39) V9M probably damaging Het
Sostdc1 C T 12: 36,367,246 (GRCm39) Q141* probably null Het
Spam1 C T 6: 24,796,109 (GRCm39) T20I probably benign Het
Tex47 T C 5: 7,354,834 (GRCm39) V5A probably benign Het
Thbs4 T C 13: 92,912,582 (GRCm39) probably null Het
Trim45 C T 3: 100,837,257 (GRCm39) P531L probably damaging Het
Tshb A T 3: 102,685,478 (GRCm39) Y50* probably null Het
Ttn T C 2: 76,599,320 (GRCm39) I19230V probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Uba6 G A 5: 86,270,288 (GRCm39) T832I probably damaging Het
Unc13d A T 11: 115,960,579 (GRCm39) V497D probably damaging Het
Usp13 T C 3: 32,892,007 (GRCm39) V62A probably damaging Het
Vmn1r215 A C 13: 23,260,189 (GRCm39) L76F probably damaging Het
Vmn1r215 G T 13: 23,260,190 (GRCm39) G77C probably damaging Het
Vmn2r5 T C 3: 64,411,497 (GRCm39) D357G probably damaging Het
Zbtb40 T C 4: 136,722,594 (GRCm39) D828G probably damaging Het
Zfp74 A T 7: 29,633,990 (GRCm39) C573S probably damaging Het
Other mutations in Or4b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Or4b1b APN 2 90,112,425 (GRCm39) missense possibly damaging 0.55
IGL01824:Or4b1b APN 2 90,112,263 (GRCm39) missense probably damaging 1.00
IGL01951:Or4b1b APN 2 90,112,351 (GRCm39) missense probably damaging 1.00
IGL02473:Or4b1b APN 2 90,112,040 (GRCm39) missense probably null 1.00
IGL02494:Or4b1b APN 2 90,112,295 (GRCm39) missense probably benign 0.35
IGL03410:Or4b1b APN 2 90,112,557 (GRCm39) missense probably damaging 1.00
R0350:Or4b1b UTSW 2 90,112,926 (GRCm39) splice site probably null
R0363:Or4b1b UTSW 2 90,112,200 (GRCm39) missense probably damaging 1.00
R0401:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R0666:Or4b1b UTSW 2 90,112,212 (GRCm39) missense probably damaging 0.96
R1860:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R1861:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R2374:Or4b1b UTSW 2 90,112,795 (GRCm39) missense possibly damaging 0.76
R4256:Or4b1b UTSW 2 90,112,406 (GRCm39) missense probably damaging 1.00
R4737:Or4b1b UTSW 2 90,112,725 (GRCm39) missense probably damaging 1.00
R4827:Or4b1b UTSW 2 90,112,547 (GRCm39) missense probably damaging 1.00
R5198:Or4b1b UTSW 2 90,126,737 (GRCm39) missense probably damaging 1.00
R6412:Or4b1b UTSW 2 90,112,202 (GRCm39) missense probably damaging 1.00
R7130:Or4b1b UTSW 2 90,112,266 (GRCm39) missense probably benign
R7317:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R7497:Or4b1b UTSW 2 90,112,098 (GRCm39) missense possibly damaging 0.74
R7762:Or4b1b UTSW 2 90,126,975 (GRCm39) nonsense probably null
R8271:Or4b1b UTSW 2 90,112,616 (GRCm39) missense possibly damaging 0.74
R8347:Or4b1b UTSW 2 90,112,020 (GRCm39) missense probably benign 0.22
R8703:Or4b1b UTSW 2 90,126,837 (GRCm39) missense probably damaging 1.00
R8794:Or4b1b UTSW 2 90,112,150 (GRCm39) nonsense probably null
R8824:Or4b1b UTSW 2 90,126,356 (GRCm39) missense probably damaging 0.98
R8910:Or4b1b UTSW 2 90,126,848 (GRCm39) missense possibly damaging 0.80
R8934:Or4b1b UTSW 2 90,112,356 (GRCm39) missense probably benign 0.07
R9548:Or4b1b UTSW 2 90,111,991 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGTGAAGCTGGAGGATG -3'
(R):5'- GGCCATCTGCAAACCTCTTC -3'

Sequencing Primer
(F):5'- AGCTGGAGGATGGTCGC -3'
(R):5'- CATCATGAGTCGTCAAGTGTGTCAC -3'
Posted On 2016-10-26