Mutagenetix > Incidental Mutation

Incidental Mutation 'R5589:Olfr1272'

437329

Institutional Source

Beutler Lab

Gene Symbol

Olfr1272

Ensembl Gene

ENSMUSG00000075061

Gene Name

olfactory receptor 1272

Synonyms

GA_x6K02T2Q125-51636504-51635578, MOR227-3

MMRRC Submission

043142-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R5589 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90280263-90292841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 90281969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 202 (G202D)

Ref Sequence

ENSEMBL: ENSMUSP00000150745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]

AlphaFold

Q8VGN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000099750
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: G202D

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	7.5e-52	PFAM
Pfam:7TM_GPCR_Srsx	33	300	1.5e-5	PFAM
Pfam:7tm_1	39	285	1.8e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117141
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,518,066	M76L	probably benign	Het
Alg1	T	A	16: 5,235,222	W116R	probably benign	Het
Ano3	A	T	2: 110,884,995	S33T	probably damaging	Het
Atp2b2	T	C	6: 113,774,439	E556G	possibly damaging	Het
BC067074	A	G	13: 113,317,950	R177G	possibly damaging	Het
Brca2	T	A	5: 150,557,132	I2761K	possibly damaging	Het
Ccdc68	G	A	18: 69,946,506	G141E	probably benign	Het
Cckbr	T	C	7: 105,434,525	V220A	probably damaging	Het
Ccnd3	G	A	17: 47,598,619	R45Q	probably damaging	Het
Cdh24	G	T	14: 54,637,375	T391N	probably damaging	Het
Cldn11	A	G	3: 31,150,246	T33A	probably damaging	Het
Clec2e	T	A	6: 129,098,428	Y50F	probably benign	Het
Cntnap1	A	G	11: 101,185,118	N943D	probably benign	Het
Dmgdh	T	C	13: 93,677,157	V70A	probably damaging	Het
Gm14496	C	A	2: 181,995,881	Y249*	probably null	Het
Gm9774	T	A	3: 92,428,805		probably benign	Het
Gmnc	T	A	16: 26,962,964	H105L	probably damaging	Het
Gpt2	A	G	8: 85,493,111	Y62C	probably damaging	Het
Ift80	T	C	3: 68,930,900	R413G	probably damaging	Het
Kctd16	C	A	18: 40,259,008	D216E	probably damaging	Het
Kif26b	T	C	1: 178,916,299	V873A	probably benign	Het
Klra4	G	T	6: 130,062,154	Q92K	probably benign	Het
L1td1	C	A	4: 98,738,104	N845K	possibly damaging	Het
Lama3	C	T	18: 12,472,220	T1077I	possibly damaging	Het
Loxhd1	T	C	18: 77,342,055	I230T	possibly damaging	Het
Lsg1	T	C	16: 30,581,001	N160S	probably damaging	Het
Lyzl4	G	A	9: 121,584,403	R24C	probably damaging	Het
Mib1	A	G	18: 10,794,488	N658S	probably benign	Het
Mmp8	T	C	9: 7,566,274	I377T	probably damaging	Het
Mtmr14	T	C	6: 113,261,282		probably null	Het
Myo1c	A	G	11: 75,657,588	T58A	possibly damaging	Het
Myo9a	C	T	9: 59,895,244	Q2005*	probably null	Het
Neu3	G	T	7: 99,823,429	P34T	probably benign	Het
Nlrp4b	G	A	7: 10,715,585	V205I	probably benign	Het
Olfr1095	A	G	2: 86,850,774	I308T	unknown	Het
Olfr1154	T	C	2: 87,903,347	T110A	probably benign	Het
Olfr1282	T	C	2: 111,335,505	N191S	possibly damaging	Het
Olfr191	A	T	16: 59,085,971	S171T	probably benign	Het
Olfr798	T	G	10: 129,625,450	T204P	probably damaging	Het
Pcsk6	T	C	7: 65,929,185		probably null	Het
Pik3c2a	A	G	7: 116,417,658	V288A	probably benign	Het
Plcd3	T	C	11: 103,077,803	D354G	probably benign	Het
Prkdc	C	A	16: 15,706,791	N1219K	probably benign	Het
Prl3d1	T	A	13: 27,094,944	Y41N	probably damaging	Het
Qrich2	C	T	11: 116,441,408	G2321R	probably damaging	Het
Rrbp1	T	C	2: 143,989,966	I94V	probably benign	Het
Serinc1	C	A	10: 57,523,166	V214L	probably benign	Het
Serpina9	G	T	12: 104,001,469	N222K	probably benign	Het
Smchd1	A	G	17: 71,440,961	Y429H	probably damaging	Het
Smyd1	C	T	6: 71,262,180	V9M	probably damaging	Het
Sostdc1	C	T	12: 36,317,247	Q141*	probably null	Het
Spam1	C	T	6: 24,796,110	T20I	probably benign	Het
Tex47	T	C	5: 7,304,834	V5A	probably benign	Het
Thbs4	T	C	13: 92,776,074		probably null	Het
Trim45	C	T	3: 100,929,941	P531L	probably damaging	Het
Tshb	A	T	3: 102,778,162	Y50*	probably null	Het
Ttn	T	C	2: 76,768,976	I19230V	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uba6	G	A	5: 86,122,429	T832I	probably damaging	Het
Unc13d	A	T	11: 116,069,753	V497D	probably damaging	Het
Usp13	T	C	3: 32,837,858	V62A	probably damaging	Het
Vmn1r215	A	C	13: 23,076,019	L76F	probably damaging	Het
Vmn1r215	G	T	13: 23,076,020	G77C	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Zbtb40	T	C	4: 136,995,283	D828G	probably damaging	Het
Zfp74	A	T	7: 29,934,565	C573S	probably damaging	Het

Other mutations in Olfr1272

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01304:Olfr1272	APN	2	90282081	missense	possibly damaging	0.55
IGL01824:Olfr1272	APN	2	90281919	missense	probably damaging	1.00
IGL01951:Olfr1272	APN	2	90282007	missense	probably damaging	1.00
IGL02473:Olfr1272	APN	2	90281696	missense	probably null	1.00
IGL02494:Olfr1272	APN	2	90281951	missense	probably benign	0.35
IGL03410:Olfr1272	APN	2	90282213	missense	probably damaging	1.00
R0350:Olfr1272	UTSW	2	90282582	splice site	probably null
R0363:Olfr1272	UTSW	2	90281856	missense	probably damaging	1.00
R0401:Olfr1272	UTSW	2	90282404	missense	probably damaging	1.00
R0666:Olfr1272	UTSW	2	90281868	missense	probably damaging	0.96
R1860:Olfr1272	UTSW	2	90282158	missense	probably damaging	1.00
R1861:Olfr1272	UTSW	2	90282158	missense	probably damaging	1.00
R2374:Olfr1272	UTSW	2	90282451	missense	possibly damaging	0.76
R4256:Olfr1272	UTSW	2	90282062	missense	probably damaging	1.00
R4737:Olfr1272	UTSW	2	90282381	missense	probably damaging	1.00
R4827:Olfr1272	UTSW	2	90282203	missense	probably damaging	1.00
R5198:Olfr1272	UTSW	2	90296393	missense	probably damaging	1.00
R6412:Olfr1272	UTSW	2	90281858	missense	probably damaging	1.00
R7130:Olfr1272	UTSW	2	90281922	missense	probably benign
R7317:Olfr1272	UTSW	2	90282404	missense	probably damaging	1.00
R7497:Olfr1272	UTSW	2	90281754	missense	possibly damaging	0.74
R7762:Olfr1272	UTSW	2	90296631	nonsense	probably null
R8271:Olfr1272	UTSW	2	90282272	missense	possibly damaging	0.74
R8347:Olfr1272	UTSW	2	90281676	missense	probably benign	0.22
R8703:Olfr1272	UTSW	2	90296493	missense	probably damaging	1.00
R8794:Olfr1272	UTSW	2	90281806	nonsense	probably null
R8824:Olfr1272	UTSW	2	90296012	missense	probably damaging	0.98
R8910:Olfr1272	UTSW	2	90296504	missense	possibly damaging	0.80
R8934:Olfr1272	UTSW	2	90282012	missense	probably benign	0.07
R9548:Olfr1272	UTSW	2	90281647	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAGTGAAGCTGGAGGATG -3'
(R):5'- GGCCATCTGCAAACCTCTTC -3'

Sequencing Primer
(F):5'- AGCTGGAGGATGGTCGC -3'
(R):5'- CATCATGAGTCGTCAAGTGTGTCAC -3'

Posted On

2016-10-26