Incidental Mutation 'R5589:Ano3'
ID437330
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
MMRRC Submission 043142-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5589 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110884995 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 33 (S33T)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: S33T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: S33T

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Cckbr T C 7: 105,434,525 V220A probably damaging Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Kif26b T C 1: 178,916,299 V873A probably benign Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mib1 A G 18: 10,794,488 N658S probably benign Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Rrbp1 T C 2: 143,989,966 I94V probably benign Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Sostdc1 C T 12: 36,317,247 Q141* probably null Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn1r215 A C 13: 23,076,019 L76F probably damaging Het
Vmn1r215 G T 13: 23,076,020 G77C probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 unclassified probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 intron probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7971:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCTTTTCTGAGGAGAAAGG -3'
(R):5'- GTTAAAGGTTGACTCTTCCTTTGAC -3'

Sequencing Primer
(F):5'- GAGAAACTGCTCTCAGGATTTTAAAG -3'
(R):5'- GGTCTCTGACATGTTGCT -3'
Posted On2016-10-26