Mutagenetix > Incidental Mutation

Incidental Mutation 'R5589:Ano3'

437330

Institutional Source

Beutler Lab

Gene Symbol

Ano3

Ensembl Gene

ENSMUSG00000074968

Gene Name

anoctamin 3

Synonyms

Tmem16c, B230324K02Rik

MMRRC Submission

043142-MU

Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R5589 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110655201-110950923 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110884995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 33 (S33T)

Ref Sequence

ENSEMBL: ENSMUSP00000097219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099623]

AlphaFold

A2AHL1

Predicted Effect

probably damaging
Transcript: ENSMUST00000099623
AA Change: S33T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: S33T

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	156	381	2.9e-70	PFAM
Pfam:Anoctamin	384	950	4.4e-138	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111019

SMART Domains

Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

Domain	Start	End	E-Value	Type
Pfam:Anoctamin	384	627	6.3e-60	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,518,066	M76L	probably benign	Het
Alg1	T	A	16: 5,235,222	W116R	probably benign	Het
Atp2b2	T	C	6: 113,774,439	E556G	possibly damaging	Het
BC067074	A	G	13: 113,317,950	R177G	possibly damaging	Het
Brca2	T	A	5: 150,557,132	I2761K	possibly damaging	Het
Ccdc68	G	A	18: 69,946,506	G141E	probably benign	Het
Cckbr	T	C	7: 105,434,525	V220A	probably damaging	Het
Ccnd3	G	A	17: 47,598,619	R45Q	probably damaging	Het
Cdh24	G	T	14: 54,637,375	T391N	probably damaging	Het
Cldn11	A	G	3: 31,150,246	T33A	probably damaging	Het
Clec2e	T	A	6: 129,098,428	Y50F	probably benign	Het
Cntnap1	A	G	11: 101,185,118	N943D	probably benign	Het
Dmgdh	T	C	13: 93,677,157	V70A	probably damaging	Het
Gm14496	C	A	2: 181,995,881	Y249*	probably null	Het
Gm9774	T	A	3: 92,428,805		probably benign	Het
Gmnc	T	A	16: 26,962,964	H105L	probably damaging	Het
Gpt2	A	G	8: 85,493,111	Y62C	probably damaging	Het
Ift80	T	C	3: 68,930,900	R413G	probably damaging	Het
Kctd16	C	A	18: 40,259,008	D216E	probably damaging	Het
Kif26b	T	C	1: 178,916,299	V873A	probably benign	Het
Klra4	G	T	6: 130,062,154	Q92K	probably benign	Het
L1td1	C	A	4: 98,738,104	N845K	possibly damaging	Het
Lama3	C	T	18: 12,472,220	T1077I	possibly damaging	Het
Loxhd1	T	C	18: 77,342,055	I230T	possibly damaging	Het
Lsg1	T	C	16: 30,581,001	N160S	probably damaging	Het
Lyzl4	G	A	9: 121,584,403	R24C	probably damaging	Het
Mib1	A	G	18: 10,794,488	N658S	probably benign	Het
Mmp8	T	C	9: 7,566,274	I377T	probably damaging	Het
Mtmr14	T	C	6: 113,261,282		probably null	Het
Myo1c	A	G	11: 75,657,588	T58A	possibly damaging	Het
Myo9a	C	T	9: 59,895,244	Q2005*	probably null	Het
Neu3	G	T	7: 99,823,429	P34T	probably benign	Het
Nlrp4b	G	A	7: 10,715,585	V205I	probably benign	Het
Olfr1095	A	G	2: 86,850,774	I308T	unknown	Het
Olfr1154	T	C	2: 87,903,347	T110A	probably benign	Het
Olfr1272	C	T	2: 90,281,969	G202D	probably damaging	Het
Olfr1282	T	C	2: 111,335,505	N191S	possibly damaging	Het
Olfr191	A	T	16: 59,085,971	S171T	probably benign	Het
Olfr798	T	G	10: 129,625,450	T204P	probably damaging	Het
Pcsk6	T	C	7: 65,929,185		probably null	Het
Pik3c2a	A	G	7: 116,417,658	V288A	probably benign	Het
Plcd3	T	C	11: 103,077,803	D354G	probably benign	Het
Prkdc	C	A	16: 15,706,791	N1219K	probably benign	Het
Prl3d1	T	A	13: 27,094,944	Y41N	probably damaging	Het
Qrich2	C	T	11: 116,441,408	G2321R	probably damaging	Het
Rrbp1	T	C	2: 143,989,966	I94V	probably benign	Het
Serinc1	C	A	10: 57,523,166	V214L	probably benign	Het
Serpina9	G	T	12: 104,001,469	N222K	probably benign	Het
Smchd1	A	G	17: 71,440,961	Y429H	probably damaging	Het
Smyd1	C	T	6: 71,262,180	V9M	probably damaging	Het
Sostdc1	C	T	12: 36,317,247	Q141*	probably null	Het
Spam1	C	T	6: 24,796,110	T20I	probably benign	Het
Tex47	T	C	5: 7,304,834	V5A	probably benign	Het
Thbs4	T	C	13: 92,776,074		probably null	Het
Trim45	C	T	3: 100,929,941	P531L	probably damaging	Het
Tshb	A	T	3: 102,778,162	Y50*	probably null	Het
Ttn	T	C	2: 76,768,976	I19230V	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uba6	G	A	5: 86,122,429	T832I	probably damaging	Het
Unc13d	A	T	11: 116,069,753	V497D	probably damaging	Het
Usp13	T	C	3: 32,837,858	V62A	probably damaging	Het
Vmn1r215	A	C	13: 23,076,019	L76F	probably damaging	Het
Vmn1r215	G	T	13: 23,076,020	G77C	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Zbtb40	T	C	4: 136,995,283	D828G	probably damaging	Het
Zfp74	A	T	7: 29,934,565	C573S	probably damaging	Het

Other mutations in Ano3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Ano3	APN	2	110771050	splice site	probably benign
IGL01066:Ano3	APN	2	110661445	missense	probably null	0.00
IGL01696:Ano3	APN	2	110667737	missense	probably damaging	1.00
IGL01729:Ano3	APN	2	110781394	splice site	probably null
IGL01785:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01786:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01992:Ano3	APN	2	110658219	missense	probably damaging	1.00
IGL02098:Ano3	APN	2	110666441	nonsense	probably null
IGL02333:Ano3	APN	2	110697199	splice site	probably benign
IGL02346:Ano3	APN	2	110770926	splice site	probably benign
IGL02352:Ano3	APN	2	110884943	nonsense	probably null
IGL02359:Ano3	APN	2	110884943	nonsense	probably null
IGL02544:Ano3	APN	2	110658249	missense	possibly damaging	0.79
IGL02750:Ano3	APN	2	110665984	splice site	probably benign
IGL02861:Ano3	APN	2	110738812	missense	probably damaging	1.00
IGL02948:Ano3	APN	2	110697018	splice site	probably benign
IGL03327:Ano3	APN	2	110697178	missense	possibly damaging	0.62
3-1:Ano3	UTSW	2	110697124	missense	probably damaging	1.00
IGL02988:Ano3	UTSW	2	110775010	missense	probably damaging	1.00
IGL03147:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
R0349:Ano3	UTSW	2	110661487	missense	probably damaging	1.00
R0426:Ano3	UTSW	2	110661174	missense	probably damaging	1.00
R0523:Ano3	UTSW	2	110884855	missense	probably benign	0.13
R0557:Ano3	UTSW	2	110862952	splice site	probably null
R0611:Ano3	UTSW	2	110885001	missense	possibly damaging	0.93
R0891:Ano3	UTSW	2	110697976	missense	probably benign	0.03
R1459:Ano3	UTSW	2	110880829	missense	probably benign	0.00
R1460:Ano3	UTSW	2	110682758	missense	probably damaging	0.97
R1773:Ano3	UTSW	2	110761455	missense	probably damaging	1.00
R1874:Ano3	UTSW	2	110884872	missense	probably benign	0.00
R1919:Ano3	UTSW	2	110885007	missense	probably benign
R2185:Ano3	UTSW	2	110775045	missense	probably benign	0.01
R2280:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2281:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2348:Ano3	UTSW	2	110783743	missense	possibly damaging	0.82
R2425:Ano3	UTSW	2	110862843	missense	probably benign
R2697:Ano3	UTSW	2	110794960	missense	possibly damaging	0.79
R3888:Ano3	UTSW	2	110885000	missense	probably damaging	0.99
R3923:Ano3	UTSW	2	110770959	missense	probably damaging	1.00
R4352:Ano3	UTSW	2	110745894	missense	possibly damaging	0.74
R4447:Ano3	UTSW	2	110761578	splice site	probably null
R4790:Ano3	UTSW	2	110884919	missense	probably benign
R4832:Ano3	UTSW	2	110667722	missense	probably damaging	1.00
R4916:Ano3	UTSW	2	110771020	missense	possibly damaging	0.74
R5113:Ano3	UTSW	2	110661480	missense	possibly damaging	0.61
R5486:Ano3	UTSW	2	110745870	missense	probably damaging	1.00
R5498:Ano3	UTSW	2	110697103	missense	possibly damaging	0.68
R5627:Ano3	UTSW	2	110756953	missense	possibly damaging	0.61
R5741:Ano3	UTSW	2	110658273	missense	probably benign	0.11
R5767:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R5883:Ano3	UTSW	2	110880864	missense	probably null	0.15
R5899:Ano3	UTSW	2	110862887	missense	probably benign	0.39
R5916:Ano3	UTSW	2	110681836	missense	probably benign	0.29
R6158:Ano3	UTSW	2	110665875	missense	probably damaging	1.00
R6315:Ano3	UTSW	2	110697039	missense	probably damaging	1.00
R6401:Ano3	UTSW	2	110775114	missense	probably benign	0.01
R6481:Ano3	UTSW	2	110795027	missense	probably benign	0.16
R6482:Ano3	UTSW	2	110697055	missense	probably damaging	1.00
R6587:Ano3	UTSW	2	110797904	splice site	probably null
R6811:Ano3	UTSW	2	110880867	missense	probably benign	0.03
R7048:Ano3	UTSW	2	110682771	nonsense	probably null
R7145:Ano3	UTSW	2	110862860	missense	probably benign	0.31
R7207:Ano3	UTSW	2	110781423	missense	probably damaging	0.96
R7215:Ano3	UTSW	2	110665932	missense	probably damaging	1.00
R7366:Ano3	UTSW	2	110757067	missense	probably damaging	1.00
R7371:Ano3	UTSW	2	110884849	critical splice donor site	probably null
R7568:Ano3	UTSW	2	110950293	start gained	probably benign
R7636:Ano3	UTSW	2	110682703	nonsense	probably null
R7888:Ano3	UTSW	2	110666428	missense	probably damaging	1.00
R7992:Ano3	UTSW	2	110775022	missense	possibly damaging	0.77
R8024:Ano3	UTSW	2	110667783	missense	probably damaging	0.99
R8074:Ano3	UTSW	2	110950232	start gained	probably benign
R8111:Ano3	UTSW	2	110783713	missense	possibly damaging	0.95
R8177:Ano3	UTSW	2	110666456	missense	probably damaging	1.00
R8297:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R8485:Ano3	UTSW	2	110667855	critical splice acceptor site	probably null
R8509:Ano3	UTSW	2	110665835	missense	possibly damaging	0.50
R8870:Ano3	UTSW	2	110783729	missense	probably benign	0.12
R9071:Ano3	UTSW	2	110795073	critical splice acceptor site	probably null
R9072:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9073:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9315:Ano3	UTSW	2	110697942	missense	probably damaging	0.97
R9376:Ano3	UTSW	2	110666437	missense	probably damaging	1.00
R9588:Ano3	UTSW	2	110697997	missense	possibly damaging	0.91
R9697:Ano3	UTSW	2	110665908	missense	probably damaging	1.00
R9716:Ano3	UTSW	2	110771031	missense	probably damaging	0.97
R9748:Ano3	UTSW	2	110658295	missense	probably damaging	1.00
RF012:Ano3	UTSW	2	110697523	missense	possibly damaging	0.83
RF013:Ano3	UTSW	2	110697036	missense	probably benign	0.30
X0058:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
Z1088:Ano3	UTSW	2	110745847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCTTTTCTGAGGAGAAAGG -3'
(R):5'- GTTAAAGGTTGACTCTTCCTTTGAC -3'

Sequencing Primer
(F):5'- GAGAAACTGCTCTCAGGATTTTAAAG -3'
(R):5'- GGTCTCTGACATGTTGCT -3'

Posted On

2016-10-26