Incidental Mutation 'R5589:Cckbr'
ID437356
Institutional Source Beutler Lab
Gene Symbol Cckbr
Ensembl Gene ENSMUSG00000030898
Gene Namecholecystokinin B receptor
SynonymsCCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor
MMRRC Submission 043142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5589 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105425731-105470898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105434525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Ref Sequence ENSEMBL: ENSMUSP00000138052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]
Predicted Effect probably damaging
Transcript: ENSMUST00000033189
AA Change: V220A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898
AA Change: V220A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 396 4.1e-59 PFAM
low complexity region 409 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181339
AA Change: V220A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898
AA Change: V220A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 301 3.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Ano3 A T 2: 110,884,995 S33T probably damaging Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Kif26b T C 1: 178,916,299 V873A probably benign Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mib1 A G 18: 10,794,488 N658S probably benign Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Rrbp1 T C 2: 143,989,966 I94V probably benign Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Sostdc1 C T 12: 36,317,247 Q141* probably null Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn1r215 A C 13: 23,076,019 L76F probably damaging Het
Vmn1r215 G T 13: 23,076,020 G77C probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Cckbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cckbr APN 7 105434242 missense probably benign 0.01
IGL01630:Cckbr APN 7 105434086 missense probably damaging 1.00
IGL01931:Cckbr APN 7 105426103 missense probably benign
IGL01955:Cckbr APN 7 105434962 missense probably damaging 0.97
IGL02219:Cckbr APN 7 105434048 missense probably damaging 1.00
IGL02820:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02858:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02878:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02946:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL03179:Cckbr APN 7 105434923 missense probably benign 0.02
FR4548:Cckbr UTSW 7 105434681 small deletion probably benign
R0380:Cckbr UTSW 7 105434991 missense probably benign 0.00
R1767:Cckbr UTSW 7 105434551 missense possibly damaging 0.56
R3890:Cckbr UTSW 7 105426169 missense probably benign 0.00
R3892:Cckbr UTSW 7 105426169 missense probably benign 0.00
R5116:Cckbr UTSW 7 105433655 missense probably damaging 1.00
R5975:Cckbr UTSW 7 105470619 missense probably benign 0.07
R6797:Cckbr UTSW 7 105434566 missense possibly damaging 0.85
R6940:Cckbr UTSW 7 105434896 missense probably benign 0.00
R7194:Cckbr UTSW 7 105435345 missense possibly damaging 0.72
R7293:Cckbr UTSW 7 105434645 missense probably benign 0.05
R7581:Cckbr UTSW 7 105433786 missense probably benign 0.05
R7793:Cckbr UTSW 7 105433591 missense probably benign 0.00
R7891:Cckbr UTSW 7 105435350 missense probably benign 0.00
R7974:Cckbr UTSW 7 105435350 missense probably benign 0.00
RF009:Cckbr UTSW 7 105434686 frame shift probably null
RF039:Cckbr UTSW 7 105434686 frame shift probably null
RF062:Cckbr UTSW 7 105434687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCAACGCTTCTAGGCTGC -3'
(R):5'- AAGGAGTTCATGCCCATCAC -3'

Sequencing Primer
(F):5'- TGGCTAGGTGGCAGAGGC -3'
(R):5'- GGAGTTCATGCCCATCACCAAAG -3'
Posted On2016-10-26