Incidental Mutation 'R5589:Sostdc1'
ID437370
Institutional Source Beutler Lab
Gene Symbol Sostdc1
Ensembl Gene ENSMUSG00000036169
Gene Namesclerostin domain containing 1
Synonymsectodin, Wise, Sostl, USAG-1
MMRRC Submission 043142-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R5589 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location36314139-36318452 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 36317247 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 141 (Q141*)
Ref Sequence ENSEMBL: ENSMUSP00000040230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041407]
Predicted Effect probably null
Transcript: ENSMUST00000041407
AA Change: Q141*
SMART Domains Protein: ENSMUSP00000040230
Gene: ENSMUSG00000036169
AA Change: Q141*

DomainStartEndE-ValueType
Pfam:Sclerostin 6 206 2.1e-112 PFAM
Pfam:DAN 47 168 3.2e-17 PFAM
Pfam:Cys_knot 72 185 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of tooth development, including tooth number, size and cusp pattern. Observed phenotypes may include cranial and palatal defects, neonatal death, altered trigeminal ganglion morphology, and resistance to cisplatin-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Ano3 A T 2: 110,884,995 S33T probably damaging Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Cckbr T C 7: 105,434,525 V220A probably damaging Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Kif26b T C 1: 178,916,299 V873A probably benign Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mib1 A G 18: 10,794,488 N658S probably benign Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Rrbp1 T C 2: 143,989,966 I94V probably benign Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn1r215 A C 13: 23,076,019 L76F probably damaging Het
Vmn1r215 G T 13: 23,076,020 G77C probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Sostdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Sostdc1 APN 12 36317122 missense probably damaging 1.00
R0588:Sostdc1 UTSW 12 36317021 splice site probably benign
R0671:Sostdc1 UTSW 12 36317341 missense probably damaging 0.99
R2184:Sostdc1 UTSW 12 36317296 missense probably damaging 0.97
R4320:Sostdc1 UTSW 12 36317420 missense probably benign 0.04
R4480:Sostdc1 UTSW 12 36317166 missense probably damaging 0.99
R5511:Sostdc1 UTSW 12 36317166 missense probably damaging 1.00
R5665:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6453:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6752:Sostdc1 UTSW 12 36314412 missense probably benign 0.00
R7232:Sostdc1 UTSW 12 36317311 missense possibly damaging 0.87
R8810:Sostdc1 UTSW 12 36317230 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCAAATACATTTCGGACGGCC -3'
(R):5'- GCAGATGCTTTCTAGTCAGTCC -3'

Sequencing Primer
(F):5'- ATTTCGGACGGCCAGTGC -3'
(R):5'- TAGTCAGTCCAGGTCTAGCTCAG -3'
Posted On2016-10-26