Mutagenetix > Incidental Mutation

Incidental Mutation 'R5589:Thbs4'

437375

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

043142-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5589 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

splice site (25 bp from exon)

DNA Base Change (assembly)

T to C at 92776074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably null
Transcript: ENSMUST00000022213

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168299

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,518,066	M76L	probably benign	Het
Alg1	T	A	16: 5,235,222	W116R	probably benign	Het
Ano3	A	T	2: 110,884,995	S33T	probably damaging	Het
Atp2b2	T	C	6: 113,774,439	E556G	possibly damaging	Het
BC067074	A	G	13: 113,317,950	R177G	possibly damaging	Het
Brca2	T	A	5: 150,557,132	I2761K	possibly damaging	Het
Ccdc68	G	A	18: 69,946,506	G141E	probably benign	Het
Cckbr	T	C	7: 105,434,525	V220A	probably damaging	Het
Ccnd3	G	A	17: 47,598,619	R45Q	probably damaging	Het
Cdh24	G	T	14: 54,637,375	T391N	probably damaging	Het
Cldn11	A	G	3: 31,150,246	T33A	probably damaging	Het
Clec2e	T	A	6: 129,098,428	Y50F	probably benign	Het
Cntnap1	A	G	11: 101,185,118	N943D	probably benign	Het
Dmgdh	T	C	13: 93,677,157	V70A	probably damaging	Het
Gm14496	C	A	2: 181,995,881	Y249*	probably null	Het
Gm9774	T	A	3: 92,428,805		probably benign	Het
Gmnc	T	A	16: 26,962,964	H105L	probably damaging	Het
Gpt2	A	G	8: 85,493,111	Y62C	probably damaging	Het
Ift80	T	C	3: 68,930,900	R413G	probably damaging	Het
Kctd16	C	A	18: 40,259,008	D216E	probably damaging	Het
Kif26b	T	C	1: 178,916,299	V873A	probably benign	Het
Klra4	G	T	6: 130,062,154	Q92K	probably benign	Het
L1td1	C	A	4: 98,738,104	N845K	possibly damaging	Het
Lama3	C	T	18: 12,472,220	T1077I	possibly damaging	Het
Loxhd1	T	C	18: 77,342,055	I230T	possibly damaging	Het
Lsg1	T	C	16: 30,581,001	N160S	probably damaging	Het
Lyzl4	G	A	9: 121,584,403	R24C	probably damaging	Het
Mib1	A	G	18: 10,794,488	N658S	probably benign	Het
Mmp8	T	C	9: 7,566,274	I377T	probably damaging	Het
Mtmr14	T	C	6: 113,261,282		probably null	Het
Myo1c	A	G	11: 75,657,588	T58A	possibly damaging	Het
Myo9a	C	T	9: 59,895,244	Q2005*	probably null	Het
Neu3	G	T	7: 99,823,429	P34T	probably benign	Het
Nlrp4b	G	A	7: 10,715,585	V205I	probably benign	Het
Olfr1095	A	G	2: 86,850,774	I308T	unknown	Het
Olfr1154	T	C	2: 87,903,347	T110A	probably benign	Het
Olfr1272	C	T	2: 90,281,969	G202D	probably damaging	Het
Olfr1282	T	C	2: 111,335,505	N191S	possibly damaging	Het
Olfr191	A	T	16: 59,085,971	S171T	probably benign	Het
Olfr798	T	G	10: 129,625,450	T204P	probably damaging	Het
Pcsk6	T	C	7: 65,929,185		probably null	Het
Pik3c2a	A	G	7: 116,417,658	V288A	probably benign	Het
Plcd3	T	C	11: 103,077,803	D354G	probably benign	Het
Prkdc	C	A	16: 15,706,791	N1219K	probably benign	Het
Prl3d1	T	A	13: 27,094,944	Y41N	probably damaging	Het
Qrich2	C	T	11: 116,441,408	G2321R	probably damaging	Het
Rrbp1	T	C	2: 143,989,966	I94V	probably benign	Het
Serinc1	C	A	10: 57,523,166	V214L	probably benign	Het
Serpina9	G	T	12: 104,001,469	N222K	probably benign	Het
Smchd1	A	G	17: 71,440,961	Y429H	probably damaging	Het
Smyd1	C	T	6: 71,262,180	V9M	probably damaging	Het
Sostdc1	C	T	12: 36,317,247	Q141*	probably null	Het
Spam1	C	T	6: 24,796,110	T20I	probably benign	Het
Tex47	T	C	5: 7,304,834	V5A	probably benign	Het
Trim45	C	T	3: 100,929,941	P531L	probably damaging	Het
Tshb	A	T	3: 102,778,162	Y50*	probably null	Het
Ttn	T	C	2: 76,768,976	I19230V	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uba6	G	A	5: 86,122,429	T832I	probably damaging	Het
Unc13d	A	T	11: 116,069,753	V497D	probably damaging	Het
Usp13	T	C	3: 32,837,858	V62A	probably damaging	Het
Vmn1r215	A	C	13: 23,076,019	L76F	probably damaging	Het
Vmn1r215	G	T	13: 23,076,020	G77C	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Zbtb40	T	C	4: 136,995,283	D828G	probably damaging	Het
Zfp74	A	T	7: 29,934,565	C573S	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGACTCCTCAAATAATTGCTATGAC -3'
(R):5'- TTGTCCTATCAGCAAACTTACGC -3'

Sequencing Primer
(F):5'- TGAAATCTAGGGTTTCTGAATTCG -3'
(R):5'- GCAAACTTACGCAAGCAATTTTC -3'

Posted On

2016-10-26