Incidental Mutation 'R5589:Mib1'
ID437387
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
MMRRC Submission 043142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5589 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10794488 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 658 (N658S)
Ref Sequence ENSEMBL: ENSMUSP00000131712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect probably benign
Transcript: ENSMUST00000052838
AA Change: N658S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: N658S

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124288
AA Change: N292S
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: N292S

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150000
SMART Domains Protein: ENSMUSP00000122879
Gene: ENSMUSG00000024294

DomainStartEndE-ValueType
Blast:ANK 2 27 5e-6 BLAST
RING 78 112 1.8e-1 SMART
RING 125 159 1.9e-1 SMART
RING 222 254 4.58e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165555
AA Change: N658S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: N658S

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Ano3 A T 2: 110,884,995 S33T probably damaging Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Cckbr T C 7: 105,434,525 V220A probably damaging Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Kif26b T C 1: 178,916,299 V873A probably benign Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Rrbp1 T C 2: 143,989,966 I94V probably benign Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Sostdc1 C T 12: 36,317,247 Q141* probably null Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn1r215 A C 13: 23,076,019 L76F probably damaging Het
Vmn1r215 G T 13: 23,076,020 G77C probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
PIT4466001:Mib1 UTSW 18 10775541 missense probably benign 0.01
PIT4468001:Mib1 UTSW 18 10798463 missense possibly damaging 0.86
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1237:Mib1 UTSW 18 10768149 missense probably damaging 1.00
R1557:Mib1 UTSW 18 10798474 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5068:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5322:Mib1 UTSW 18 10792975 missense probably damaging 1.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
R7242:Mib1 UTSW 18 10741011 missense probably damaging 1.00
R7870:Mib1 UTSW 18 10798446 missense possibly damaging 0.75
R7912:Mib1 UTSW 18 10778187 missense probably damaging 1.00
R7953:Mib1 UTSW 18 10798446 missense possibly damaging 0.75
R7993:Mib1 UTSW 18 10778187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTGAGGTAGTCACTG -3'
(R):5'- ACTAGGCATTAACTCCTTATCCCAC -3'

Sequencing Primer
(F):5'- AGTCACTGTAAAGGAGATACTCATG -3'
(R):5'- TTATCCCACAGACACAGATGAAAGG -3'
Posted On2016-10-26