Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Tnfrsf21'

43745

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

038340-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R0046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43038213 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 239 (H239Y)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

AlphaFold

Q9EPU5

Predicted Effect

probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Meta Mutation Damage Score

0.0680

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Card11	T	C	5: 140,908,524	T117A	possibly damaging	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pik3c2a	A	T	7: 116,354,072	I1196N	probably damaging	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rnf17	T	C	14: 56,471,373	L750P	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sis	T	G	3: 72,932,094	N813T	probably benign	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Stag3	C	T	5: 138,283,023		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
R8865:Tnfrsf21	UTSW	17	43085481	missense	probably damaging	1.00
R8991:Tnfrsf21	UTSW	17	43085408	missense	probably benign	0.03
R9088:Tnfrsf21	UTSW	17	43037716	missense	probably damaging	1.00
R9150:Tnfrsf21	UTSW	17	43087800	missense	probably damaging	1.00
R9220:Tnfrsf21	UTSW	17	43087910	missense	probably damaging	1.00
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTAAAGCTCACACGGACTGTCTGG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'

Posted On

2013-05-29