Incidental Mutation 'R5591:Mbd5'
ID437505
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 043269-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5591 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49274669 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 958 (Q958H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112754] [ENSMUST00000132717] [ENSMUST00000197712]
Predicted Effect probably benign
Transcript: ENSMUST00000047413
AA Change: Q1219H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: Q1219H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112754
AA Change: Q989H

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: Q989H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122841
AA Change: Q958H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: Q958H

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132717
AA Change: Q327H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137021
Gene: ENSMUSG00000036792
AA Change: Q327H

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 42 56 N/A INTRINSIC
low complexity region 100 118 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
low complexity region 220 244 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 314 337 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 424 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196045
Predicted Effect probably benign
Transcript: ENSMUST00000196831
Predicted Effect probably benign
Transcript: ENSMUST00000197712
SMART Domains Protein: ENSMUSP00000143413
Gene: ENSMUSG00000036792

DomainStartEndE-ValueType
SCOP:d1khca_ 63 93 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T C 7: 45,144,652 E13G probably null Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Bub1 A T 2: 127,819,343 M276K probably benign Het
Casp14 A T 10: 78,714,345 D156E unknown Het
Ccdc82 T A 9: 13,272,503 probably null Het
Cdc42bpb T C 12: 111,323,087 N436S probably benign Het
Cyp2j12 A G 4: 96,141,122 probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Daxx T C 17: 33,911,688 S226P probably damaging Het
Gm13101 G T 4: 143,964,960 L398I probably damaging Het
Gm3676 T C 14: 41,643,224 Y158C probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnai1 A T 5: 18,271,846 I285K probably benign Het
Gpr179 C T 11: 97,345,755 V417I probably benign Het
Helz2 C T 2: 181,240,258 M247I probably damaging Het
Hmcn2 C T 2: 31,344,047 L275F probably damaging Het
Ifi27l2b A G 12: 103,451,307 V207A probably damaging Het
Isg20l2 C T 3: 87,930,424 probably benign Het
Itga6 A G 2: 71,840,590 D221G probably damaging Het
Lca5l T C 16: 96,178,729 Y67C probably damaging Het
Loxl3 T A 6: 83,048,037 C249S probably damaging Het
Luc7l3 T C 11: 94,293,234 probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpp6 A G 6: 50,180,179 S276G probably benign Het
Mrm3 G A 11: 76,250,081 R305H probably benign Het
Olfr1261 A G 2: 89,993,407 T5A possibly damaging Het
Olfr1328 A T 4: 118,934,461 I127K probably damaging Het
Olfr170 T A 16: 19,605,858 Q270L probably damaging Het
Olfr320 A G 11: 58,684,125 N84S probably benign Het
Olfr347 A T 2: 36,735,232 I304F probably benign Het
Olfr635 G T 7: 103,980,113 R307L probably benign Het
Olfr709-ps1 A T 7: 106,927,282 M59K probably damaging Het
P3h3 C T 6: 124,854,695 probably benign Het
Plekhg3 C T 12: 76,560,292 S42L possibly damaging Het
Polq A G 16: 37,011,885 probably benign Het
Pramef25 T C 4: 143,948,807 Y483C probably damaging Het
Raph1 G A 1: 60,501,746 probably benign Het
Rnf144b G A 13: 47,242,954 probably null Het
Ryr2 A G 13: 11,595,014 S4309P probably benign Het
Sash1 A T 10: 8,725,718 S1158T probably benign Het
Sim2 T C 16: 94,097,189 V94A probably damaging Het
Sirt5 A G 13: 43,371,841 D42G possibly damaging Het
Skiv2l2 A T 13: 112,927,356 M1K probably null Het
Smarcal1 A T 1: 72,591,253 K155N probably damaging Het
Spam1 A G 6: 24,800,546 Y428C probably damaging Het
Spef2 T C 15: 9,583,836 N1655S probably benign Het
Sympk A G 7: 19,054,039 E1160G probably damaging Het
Tmem192 A G 8: 64,965,602 Y168C possibly damaging Het
Ttn T A 2: 76,709,668 M25998L probably benign Het
Usp48 A G 4: 137,652,652 probably benign Het
Vamp4 A G 1: 162,588,242 I71V possibly damaging Het
Washc5 C A 15: 59,369,163 D108Y probably damaging Het
Wdfy4 T A 14: 33,107,130 H1043L probably benign Het
Zcchc14 C T 8: 121,605,448 probably benign Het
Zfp407 A G 18: 84,561,137 F617S probably damaging Het
Zfp869 T A 8: 69,707,692 N77I probably benign Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
R7366:Mbd5 UTSW 2 49274568 missense probably benign
R7385:Mbd5 UTSW 2 49272449 missense probably benign 0.01
R7402:Mbd5 UTSW 2 49257554 missense probably damaging 1.00
R7462:Mbd5 UTSW 2 49257880 missense possibly damaging 0.52
R7549:Mbd5 UTSW 2 49251343 missense probably damaging 0.97
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Z1176:Mbd5 UTSW 2 49279308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCAATTTTCCTATGAAGCTCAGC -3'
(R):5'- TGTCAATAGGCTCTAAAGGGTAC -3'

Sequencing Primer
(F):5'- TTATCAGGTGCAAAGACAACCATAAG -3'
(R):5'- GGCTCTAAAGGGTACTTTTTCATTC -3'
Posted On2016-10-26