Incidental Mutation 'R5591:Bub1'
ID437509
Institutional Source Beutler Lab
Gene Symbol Bub1
Ensembl Gene ENSMUSG00000027379
Gene NameBUB1, mitotic checkpoint serine/threonine kinase
SynonymsD2Xrf87, Bub1a
MMRRC Submission 043269-MU
Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5591 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127801122-127831865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127819343 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 276 (M276K)
Ref Sequence ENSEMBL: ENSMUSP00000028858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028858]
Predicted Effect probably benign
Transcript: ENSMUST00000028858
AA Change: M276K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379
AA Change: M276K

DomainStartEndE-ValueType
Mad3_BUB1_I 4 126 7.41e-46 SMART
low complexity region 216 225 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Pfam:Pkinase_Tyr 762 1011 9.3e-10 PFAM
Pfam:Pkinase 762 1037 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143824
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T C 7: 45,144,652 E13G probably null Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Casp14 A T 10: 78,714,345 D156E unknown Het
Ccdc82 T A 9: 13,272,503 probably null Het
Cdc42bpb T C 12: 111,323,087 N436S probably benign Het
Cyp2j12 A G 4: 96,141,122 probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Daxx T C 17: 33,911,688 S226P probably damaging Het
Gm13101 G T 4: 143,964,960 L398I probably damaging Het
Gm3676 T C 14: 41,643,224 Y158C probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnai1 A T 5: 18,271,846 I285K probably benign Het
Gpr179 C T 11: 97,345,755 V417I probably benign Het
Helz2 C T 2: 181,240,258 M247I probably damaging Het
Hmcn2 C T 2: 31,344,047 L275F probably damaging Het
Ifi27l2b A G 12: 103,451,307 V207A probably damaging Het
Isg20l2 C T 3: 87,930,424 probably benign Het
Itga6 A G 2: 71,840,590 D221G probably damaging Het
Lca5l T C 16: 96,178,729 Y67C probably damaging Het
Loxl3 T A 6: 83,048,037 C249S probably damaging Het
Luc7l3 T C 11: 94,293,234 probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mbd5 A C 2: 49,274,669 Q958H probably damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpp6 A G 6: 50,180,179 S276G probably benign Het
Mrm3 G A 11: 76,250,081 R305H probably benign Het
Olfr1261 A G 2: 89,993,407 T5A possibly damaging Het
Olfr1328 A T 4: 118,934,461 I127K probably damaging Het
Olfr170 T A 16: 19,605,858 Q270L probably damaging Het
Olfr320 A G 11: 58,684,125 N84S probably benign Het
Olfr347 A T 2: 36,735,232 I304F probably benign Het
Olfr635 G T 7: 103,980,113 R307L probably benign Het
Olfr709-ps1 A T 7: 106,927,282 M59K probably damaging Het
P3h3 C T 6: 124,854,695 probably benign Het
Plekhg3 C T 12: 76,560,292 S42L possibly damaging Het
Polq A G 16: 37,011,885 probably benign Het
Pramef25 T C 4: 143,948,807 Y483C probably damaging Het
Raph1 G A 1: 60,501,746 probably benign Het
Rnf144b G A 13: 47,242,954 probably null Het
Ryr2 A G 13: 11,595,014 S4309P probably benign Het
Sash1 A T 10: 8,725,718 S1158T probably benign Het
Sim2 T C 16: 94,097,189 V94A probably damaging Het
Sirt5 A G 13: 43,371,841 D42G possibly damaging Het
Skiv2l2 A T 13: 112,927,356 M1K probably null Het
Smarcal1 A T 1: 72,591,253 K155N probably damaging Het
Spam1 A G 6: 24,800,546 Y428C probably damaging Het
Spef2 T C 15: 9,583,836 N1655S probably benign Het
Sympk A G 7: 19,054,039 E1160G probably damaging Het
Tmem192 A G 8: 64,965,602 Y168C possibly damaging Het
Ttn T A 2: 76,709,668 M25998L probably benign Het
Usp48 A G 4: 137,652,652 probably benign Het
Vamp4 A G 1: 162,588,242 I71V possibly damaging Het
Washc5 C A 15: 59,369,163 D108Y probably damaging Het
Wdfy4 T A 14: 33,107,130 H1043L probably benign Het
Zcchc14 C T 8: 121,605,448 probably benign Het
Zfp407 A G 18: 84,561,137 F617S probably damaging Het
Zfp869 T A 8: 69,707,692 N77I probably benign Het
Other mutations in Bub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Bub1 APN 2 127829472 missense probably damaging 0.96
IGL00795:Bub1 APN 2 127821815 missense probably benign 0.00
IGL00966:Bub1 APN 2 127810663 missense probably damaging 1.00
IGL01807:Bub1 APN 2 127812977 missense probably benign 0.00
IGL02212:Bub1 APN 2 127805351 missense probably damaging 1.00
IGL02537:Bub1 APN 2 127801347 nonsense probably null
IGL02935:Bub1 APN 2 127801295 missense probably damaging 1.00
IGL03064:Bub1 APN 2 127817453 missense probably benign 0.00
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0325:Bub1 UTSW 2 127801394 nonsense probably null
R1502:Bub1 UTSW 2 127827419 missense probably damaging 0.98
R1627:Bub1 UTSW 2 127809013 missense probably benign 0.01
R1743:Bub1 UTSW 2 127813850 missense probably damaging 1.00
R1778:Bub1 UTSW 2 127803122 missense possibly damaging 0.60
R2043:Bub1 UTSW 2 127804220 missense probably damaging 1.00
R2108:Bub1 UTSW 2 127819335 missense probably damaging 0.99
R2165:Bub1 UTSW 2 127801281 missense probably benign 0.01
R2190:Bub1 UTSW 2 127810725 missense probably benign 0.06
R2507:Bub1 UTSW 2 127801423 missense probably benign 0.04
R2508:Bub1 UTSW 2 127801423 missense probably benign 0.04
R3836:Bub1 UTSW 2 127814886 missense probably damaging 1.00
R3862:Bub1 UTSW 2 127814756 splice site probably benign
R3904:Bub1 UTSW 2 127821942 missense probably benign 0.08
R4373:Bub1 UTSW 2 127805236 intron probably benign
R4580:Bub1 UTSW 2 127829676 critical splice donor site probably null
R4751:Bub1 UTSW 2 127823938 intron probably benign
R5239:Bub1 UTSW 2 127821696 missense probably damaging 1.00
R5498:Bub1 UTSW 2 127814709 missense possibly damaging 0.59
R5672:Bub1 UTSW 2 127804880 missense possibly damaging 0.70
R5907:Bub1 UTSW 2 127819222 missense probably benign 0.02
R6714:Bub1 UTSW 2 127814732 missense probably benign 0.08
R6781:Bub1 UTSW 2 127807857 missense probably damaging 0.99
R6931:Bub1 UTSW 2 127801382 missense probably damaging 1.00
R7057:Bub1 UTSW 2 127829527 missense probably benign
R7094:Bub1 UTSW 2 127821761 missense probably null 0.99
Z1176:Bub1 UTSW 2 127829565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGTCTGTGGAGACTAGC -3'
(R):5'- TTTAATAGTAACTATGGTGAGGACAGG -3'

Sequencing Primer
(F):5'- TTGAGCGAAACATTTCCACTCAGTC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2016-10-26