Incidental Mutation 'R0046:Sptbn2'
ID43751
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Namespectrin beta, non-erythrocytic 2
SynonymsSpnb3
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4711208-4752353 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 4745377 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
Predicted Effect probably benign
Transcript: ENSMUST00000008991
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 intron probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7954:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7960:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTGGAAACGCCTGAGCCATGAG -3'
(R):5'- TGTCTGCTAACTGCTTGCCAAGTC -3'

Sequencing Primer
(F):5'- CTGAGCCATGAGCTGGAG -3'
(R):5'- GGGTCAAGGCTCATGATACTCAC -3'
Posted On2013-05-29