Incidental Mutation 'R5591:Ccdc82'
ID437530
Institutional Source Beutler Lab
Gene Symbol Ccdc82
Ensembl Gene ENSMUSG00000079084
Gene Namecoiled-coil domain containing 82
Synonyms
MMRRC Submission 043269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5591 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location13246955-13292520 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 13272503 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110583] [ENSMUST00000217444]
Predicted Effect probably null
Transcript: ENSMUST00000110583
SMART Domains Protein: ENSMUSP00000106212
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 1.8e-50 PFAM
low complexity region 218 231 N/A INTRINSIC
Pfam:DUF4211 273 432 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215778
Predicted Effect probably null
Transcript: ENSMUST00000217444
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T C 7: 45,144,652 E13G probably null Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Bub1 A T 2: 127,819,343 M276K probably benign Het
Casp14 A T 10: 78,714,345 D156E unknown Het
Cdc42bpb T C 12: 111,323,087 N436S probably benign Het
Cyp2j12 A G 4: 96,141,122 probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Daxx T C 17: 33,911,688 S226P probably damaging Het
Gm13101 G T 4: 143,964,960 L398I probably damaging Het
Gm3676 T C 14: 41,643,224 Y158C probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnai1 A T 5: 18,271,846 I285K probably benign Het
Gpr179 C T 11: 97,345,755 V417I probably benign Het
Helz2 C T 2: 181,240,258 M247I probably damaging Het
Hmcn2 C T 2: 31,344,047 L275F probably damaging Het
Ifi27l2b A G 12: 103,451,307 V207A probably damaging Het
Isg20l2 C T 3: 87,930,424 probably benign Het
Itga6 A G 2: 71,840,590 D221G probably damaging Het
Lca5l T C 16: 96,178,729 Y67C probably damaging Het
Loxl3 T A 6: 83,048,037 C249S probably damaging Het
Luc7l3 T C 11: 94,293,234 probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mbd5 A C 2: 49,274,669 Q958H probably damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpp6 A G 6: 50,180,179 S276G probably benign Het
Mrm3 G A 11: 76,250,081 R305H probably benign Het
Olfr1261 A G 2: 89,993,407 T5A possibly damaging Het
Olfr1328 A T 4: 118,934,461 I127K probably damaging Het
Olfr170 T A 16: 19,605,858 Q270L probably damaging Het
Olfr320 A G 11: 58,684,125 N84S probably benign Het
Olfr347 A T 2: 36,735,232 I304F probably benign Het
Olfr635 G T 7: 103,980,113 R307L probably benign Het
Olfr709-ps1 A T 7: 106,927,282 M59K probably damaging Het
P3h3 C T 6: 124,854,695 probably benign Het
Plekhg3 C T 12: 76,560,292 S42L possibly damaging Het
Polq A G 16: 37,011,885 probably benign Het
Pramef25 T C 4: 143,948,807 Y483C probably damaging Het
Raph1 G A 1: 60,501,746 probably benign Het
Rnf144b G A 13: 47,242,954 probably null Het
Ryr2 A G 13: 11,595,014 S4309P probably benign Het
Sash1 A T 10: 8,725,718 S1158T probably benign Het
Sim2 T C 16: 94,097,189 V94A probably damaging Het
Sirt5 A G 13: 43,371,841 D42G possibly damaging Het
Skiv2l2 A T 13: 112,927,356 M1K probably null Het
Smarcal1 A T 1: 72,591,253 K155N probably damaging Het
Spam1 A G 6: 24,800,546 Y428C probably damaging Het
Spef2 T C 15: 9,583,836 N1655S probably benign Het
Sympk A G 7: 19,054,039 E1160G probably damaging Het
Tmem192 A G 8: 64,965,602 Y168C possibly damaging Het
Ttn T A 2: 76,709,668 M25998L probably benign Het
Usp48 A G 4: 137,652,652 probably benign Het
Vamp4 A G 1: 162,588,242 I71V possibly damaging Het
Washc5 C A 15: 59,369,163 D108Y probably damaging Het
Wdfy4 T A 14: 33,107,130 H1043L probably benign Het
Zcchc14 C T 8: 121,605,448 probably benign Het
Zfp407 A G 18: 84,561,137 F617S probably damaging Het
Zfp869 T A 8: 69,707,692 N77I probably benign Het
Other mutations in Ccdc82
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1276:Ccdc82 UTSW 9 13281413 missense probably benign 0.03
R1580:Ccdc82 UTSW 9 13252760 missense probably damaging 1.00
R1662:Ccdc82 UTSW 9 13262772 missense probably damaging 1.00
R3619:Ccdc82 UTSW 9 13252306 missense probably benign 0.05
R3858:Ccdc82 UTSW 9 13252079 start gained probably benign
R3963:Ccdc82 UTSW 9 13252386 missense possibly damaging 0.78
R4287:Ccdc82 UTSW 9 13253418 missense probably benign 0.13
R4674:Ccdc82 UTSW 9 13252635 missense probably benign 0.45
R6122:Ccdc82 UTSW 9 13266412 missense probably benign 0.01
R6175:Ccdc82 UTSW 9 13272479 missense probably damaging 1.00
R6434:Ccdc82 UTSW 9 13252034 intron probably benign
R6457:Ccdc82 UTSW 9 13272426 missense possibly damaging 0.73
R6825:Ccdc82 UTSW 9 13251976 intron probably benign
R7191:Ccdc82 UTSW 9 13252472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAATTGTCAGGAGCGGGTTGAAAG -3'
(R):5'- TTCAAAATTGTACCCTGGGTTAGG -3'

Sequencing Primer
(F):5'- GCGGGTTGAAAGCTACTCTAAC -3'
(R):5'- TTAGCAAGCTGAGACCCTCCG -3'
Posted On2016-10-26