Incidental Mutation 'R5591:Rnf144b'
ID437544
Institutional Source Beutler Lab
Gene Symbol Rnf144b
Ensembl Gene ENSMUSG00000038068
Gene Namering finger protein 144B
SynonymsIbrdc2, E130105P19Rik
MMRRC Submission 043269-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5591 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47122656-47247991 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 47242954 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068891] [ENSMUST00000068891] [ENSMUST00000110111] [ENSMUST00000110111]
Predicted Effect probably null
Transcript: ENSMUST00000068891
SMART Domains Protein: ENSMUSP00000071017
Gene: ENSMUSG00000038068

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068891
SMART Domains Protein: ENSMUSP00000071017
Gene: ENSMUSG00000038068

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110111
SMART Domains Protein: ENSMUSP00000105738
Gene: ENSMUSG00000038068

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110111
SMART Domains Protein: ENSMUSP00000105738
Gene: ENSMUSG00000038068

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T C 7: 45,144,652 E13G probably null Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Bub1 A T 2: 127,819,343 M276K probably benign Het
Casp14 A T 10: 78,714,345 D156E unknown Het
Ccdc82 T A 9: 13,272,503 probably null Het
Cdc42bpb T C 12: 111,323,087 N436S probably benign Het
Cyp2j12 A G 4: 96,141,122 probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Daxx T C 17: 33,911,688 S226P probably damaging Het
Gm13101 G T 4: 143,964,960 L398I probably damaging Het
Gm3676 T C 14: 41,643,224 Y158C probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnai1 A T 5: 18,271,846 I285K probably benign Het
Gpr179 C T 11: 97,345,755 V417I probably benign Het
Helz2 C T 2: 181,240,258 M247I probably damaging Het
Hmcn2 C T 2: 31,344,047 L275F probably damaging Het
Ifi27l2b A G 12: 103,451,307 V207A probably damaging Het
Isg20l2 C T 3: 87,930,424 probably benign Het
Itga6 A G 2: 71,840,590 D221G probably damaging Het
Lca5l T C 16: 96,178,729 Y67C probably damaging Het
Loxl3 T A 6: 83,048,037 C249S probably damaging Het
Luc7l3 T C 11: 94,293,234 probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mbd5 A C 2: 49,274,669 Q958H probably damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpp6 A G 6: 50,180,179 S276G probably benign Het
Mrm3 G A 11: 76,250,081 R305H probably benign Het
Olfr1261 A G 2: 89,993,407 T5A possibly damaging Het
Olfr1328 A T 4: 118,934,461 I127K probably damaging Het
Olfr170 T A 16: 19,605,858 Q270L probably damaging Het
Olfr320 A G 11: 58,684,125 N84S probably benign Het
Olfr347 A T 2: 36,735,232 I304F probably benign Het
Olfr635 G T 7: 103,980,113 R307L probably benign Het
Olfr709-ps1 A T 7: 106,927,282 M59K probably damaging Het
P3h3 C T 6: 124,854,695 probably benign Het
Plekhg3 C T 12: 76,560,292 S42L possibly damaging Het
Polq A G 16: 37,011,885 probably benign Het
Pramef25 T C 4: 143,948,807 Y483C probably damaging Het
Raph1 G A 1: 60,501,746 probably benign Het
Ryr2 A G 13: 11,595,014 S4309P probably benign Het
Sash1 A T 10: 8,725,718 S1158T probably benign Het
Sim2 T C 16: 94,097,189 V94A probably damaging Het
Sirt5 A G 13: 43,371,841 D42G possibly damaging Het
Skiv2l2 A T 13: 112,927,356 M1K probably null Het
Smarcal1 A T 1: 72,591,253 K155N probably damaging Het
Spam1 A G 6: 24,800,546 Y428C probably damaging Het
Spef2 T C 15: 9,583,836 N1655S probably benign Het
Sympk A G 7: 19,054,039 E1160G probably damaging Het
Tmem192 A G 8: 64,965,602 Y168C possibly damaging Het
Ttn T A 2: 76,709,668 M25998L probably benign Het
Usp48 A G 4: 137,652,652 probably benign Het
Vamp4 A G 1: 162,588,242 I71V possibly damaging Het
Washc5 C A 15: 59,369,163 D108Y probably damaging Het
Wdfy4 T A 14: 33,107,130 H1043L probably benign Het
Zcchc14 C T 8: 121,605,448 probably benign Het
Zfp407 A G 18: 84,561,137 F617S probably damaging Het
Zfp869 T A 8: 69,707,692 N77I probably benign Het
Other mutations in Rnf144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Rnf144b APN 13 47220488 splice site probably benign
IGL00987:Rnf144b APN 13 47207493 missense possibly damaging 0.57
IGL02712:Rnf144b APN 13 47239779 missense probably damaging 1.00
IGL03002:Rnf144b APN 13 47242883 missense probably damaging 1.00
R0418:Rnf144b UTSW 13 47244490 missense probably benign 0.00
R0464:Rnf144b UTSW 13 47242887 nonsense probably null
R0652:Rnf144b UTSW 13 47220507 missense probably damaging 1.00
R0932:Rnf144b UTSW 13 47220525 missense probably null 0.44
R1472:Rnf144b UTSW 13 47242885 missense probably damaging 1.00
R2341:Rnf144b UTSW 13 47220500 missense probably benign 0.05
R4306:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4308:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4523:Rnf144b UTSW 13 47207537 missense probably benign 0.08
R7323:Rnf144b UTSW 13 47239782 missense probably damaging 1.00
R7887:Rnf144b UTSW 13 47239811 missense probably damaging 1.00
X0064:Rnf144b UTSW 13 47237464 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGAACTGCACACTTGATG -3'
(R):5'- CCTCCCATGTTTTGCAAGAGC -3'

Sequencing Primer
(F):5'- GAACTGCACACTTGATGCTCAC -3'
(R):5'- TTGGCTGGTCACCCTAACG -3'
Posted On2016-10-26