Incidental Mutation 'R5592:Pitpnm2'
ID437566
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Namephosphatidylinositol transfer protein, membrane-associated 2
SynonymsNIR3, RDGBA2, Rdgb2
MMRRC Submission 043144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124118690-124249760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124142149 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Ref Sequence ENSEMBL: ENSMUSP00000124292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161644] [ENSMUST00000161938] [ENSMUST00000162812]
Predicted Effect probably damaging
Transcript: ENSMUST00000086123
AA Change: E112G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: E112G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159677
AA Change: E112G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: E112G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161273
AA Change: E112G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: E112G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161530
Predicted Effect probably benign
Transcript: ENSMUST00000161644
Predicted Effect probably damaging
Transcript: ENSMUST00000161938
AA Change: E112G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: E112G

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162812
AA Change: E112G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: E112G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Meta Mutation Damage Score 0.7485 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Galnt16 T C 12: 80,588,519 V343A probably damaging Het
Gimap4 A T 6: 48,691,158 E154D probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Ogdh A T 11: 6,316,763 probably null Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rb1 A G 14: 73,211,747 Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vav1 A G 17: 57,304,835 Y483C probably benign Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
PIT4131001:Pitpnm2 UTSW 5 124131115 missense probably benign 0.01
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2008:Pitpnm2 UTSW 5 124152621 start codon destroyed probably damaging 0.99
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4407:Pitpnm2 UTSW 5 124152615 missense possibly damaging 0.57
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5151:Pitpnm2 UTSW 5 124136386 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6846:Pitpnm2 UTSW 5 124131171 missense probably benign 0.00
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATCCAGTGCACTCTCAGGAG -3'
(R):5'- TGTCACATCTTTAGCCAACACC -3'

Sequencing Primer
(F):5'- ACTCTCAGGAGGAGCTCAG -3'
(R):5'- TGGAGCAGTAGCCAAGACCTTTC -3'
Posted On2016-10-26