Incidental Mutation 'R5592:Gimap4'
ID437569
Institutional Source Beutler Lab
Gene Symbol Gimap4
Ensembl Gene ENSMUSG00000054435
Gene NameGTPase, IMAP family member 4
SynonymsIan1, E430007K16Rik
MMRRC Submission 043144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48684549-48692060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48691158 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 154 (E154D)
Ref Sequence ENSEMBL: ENSMUSP00000112530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067506] [ENSMUST00000090070] [ENSMUST00000118802] [ENSMUST00000119575] [ENSMUST00000121957] [ENSMUST00000156770]
Predicted Effect probably benign
Transcript: ENSMUST00000067506
SMART Domains Protein: ENSMUSP00000068398
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 218 4.2e-72 PFAM
Pfam:MMR_HSR1 32 186 2.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090070
AA Change: E282D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087524
Gene: ENSMUSG00000054435
AA Change: E282D

DomainStartEndE-ValueType
Pfam:AIG1 31 242 1.5e-80 PFAM
Pfam:MMR_HSR1 32 170 1.6e-10 PFAM
low complexity region 265 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118802
AA Change: E154D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112530
Gene: ENSMUSG00000054435
AA Change: E154D

DomainStartEndE-ValueType
Pfam:AIG1 31 53 1.6e-7 PFAM
Pfam:AIG1 48 114 6.4e-17 PFAM
low complexity region 137 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119575
SMART Domains Protein: ENSMUSP00000113989
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
SCOP:d1zin_1 31 50 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121957
SMART Domains Protein: ENSMUSP00000113016
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 55 4.3e-8 PFAM
Pfam:AIG1 48 89 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156770
SMART Domains Protein: ENSMUSP00000122070
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 69 6.7e-17 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show no detectable alterations in T-cell development, selection and activation; however, mutant T cells exhibit a delay in the execution of programmed cell death induced by intrinsic stimuli downstream of caspase-3 activation and phosphatidylserine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Galnt16 T C 12: 80,588,519 V343A probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Ogdh A T 11: 6,316,763 probably null Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Pitpnm2 T C 5: 124,142,149 E112G probably damaging Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rb1 A G 14: 73,211,747 Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vav1 A G 17: 57,304,835 Y483C probably benign Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Gimap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gimap4 APN 6 48690938 missense probably damaging 1.00
IGL01917:Gimap4 APN 6 48690920 missense probably benign 0.02
IGL02302:Gimap4 APN 6 48690413 missense probably damaging 1.00
IGL02679:Gimap4 APN 6 48690495 nonsense probably null
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1584:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R2079:Gimap4 UTSW 6 48690947 missense possibly damaging 0.46
R2118:Gimap4 UTSW 6 48690971 missense probably benign 0.24
R2566:Gimap4 UTSW 6 48690865 missense probably damaging 1.00
R4279:Gimap4 UTSW 6 48690577 missense probably benign 0.22
R5597:Gimap4 UTSW 6 48690764 missense probably damaging 1.00
R6162:Gimap4 UTSW 6 48690721 missense probably damaging 0.97
R6354:Gimap4 UTSW 6 48686880 missense possibly damaging 0.53
R6658:Gimap4 UTSW 6 48691404 missense possibly damaging 0.65
X0050:Gimap4 UTSW 6 48690800 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGTGCCGAGTGTGTGATC -3'
(R):5'- TAGAGCATTTGGGCATCGG -3'

Sequencing Primer
(F):5'- TGTGTGATCCAGAAAGAGACCTTG -3'
(R):5'- GCACTATAGGGCAGGGTTATC -3'
Posted On2016-10-26