Incidental Mutation 'R5592:Mlip'
ID437574
Institutional Source Beutler Lab
Gene Symbol Mlip
Ensembl Gene ENSMUSG00000032355
Gene Namemuscular LMNA-interacting protein
Synonyms2310046A06Rik, CIP, cardiac ISL1-interacting protein
MMRRC Submission 043144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location77102081-77352969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77230482 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 381 (S381L)
Ref Sequence ENSEMBL: ENSMUSP00000138864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034910] [ENSMUST00000183955] [ENSMUST00000184006] [ENSMUST00000184138] [ENSMUST00000184316] [ENSMUST00000184322] [ENSMUST00000184415] [ENSMUST00000184848] [ENSMUST00000185039] [ENSMUST00000185144]
Predicted Effect probably benign
Transcript: ENSMUST00000034910
SMART Domains Protein: ENSMUSP00000034910
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 69 155 1.3e-24 PFAM
Pfam:MLIP 175 269 1.9e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183955
AA Change: S381L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138864
Gene: ENSMUSG00000032355
AA Change: S381L

DomainStartEndE-ValueType
Pfam:MLIP 111 210 7.6e-37 PFAM
low complexity region 351 363 N/A INTRINSIC
low complexity region 375 387 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 437 455 N/A INTRINSIC
low complexity region 528 541 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
Pfam:MLIP 654 881 8.5e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184006
SMART Domains Protein: ENSMUSP00000139002
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 154 1.5e-37 PFAM
Pfam:MLIP 175 270 1e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184106
SMART Domains Protein: ENSMUSP00000138851
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 38 138 2.4e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184138
SMART Domains Protein: ENSMUSP00000139188
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 157 3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184316
SMART Domains Protein: ENSMUSP00000138938
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 111 200 5.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184322
AA Change: S304L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139055
Gene: ENSMUSG00000032355
AA Change: S304L

DomainStartEndE-ValueType
Pfam:MLIP 59 149 5.3e-37 PFAM
low complexity region 274 286 N/A INTRINSIC
low complexity region 298 310 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 360 378 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
low complexity region 559 574 N/A INTRINSIC
Pfam:MLIP 577 683 5.8e-23 PFAM
Pfam:MLIP 681 775 6.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184415
SMART Domains Protein: ENSMUSP00000139251
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 119 374 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184848
SMART Domains Protein: ENSMUSP00000139242
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 154 3.7e-38 PFAM
Pfam:MLIP 153 227 5.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185039
SMART Domains Protein: ENSMUSP00000139109
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 119 207 3.9e-38 PFAM
Pfam:MLIP 205 279 6.4e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185144
AA Change: S337L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139362
Gene: ENSMUSG00000032355
AA Change: S337L

DomainStartEndE-ValueType
Pfam:MLIP 67 166 6.3e-37 PFAM
low complexity region 307 319 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 375 386 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 592 607 N/A INTRINSIC
Pfam:MLIP 609 836 4.7e-102 PFAM
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased cardiac sensitivity to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Galnt16 T C 12: 80,588,519 V343A probably damaging Het
Gimap4 A T 6: 48,691,158 E154D probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Ogdh A T 11: 6,316,763 probably null Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Pitpnm2 T C 5: 124,142,149 E112G probably damaging Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rb1 A G 14: 73,211,747 Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vav1 A G 17: 57,304,835 Y483C probably benign Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Mlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Mlip APN 9 77239417 missense possibly damaging 0.89
IGL01727:Mlip APN 9 77239748 missense probably damaging 0.99
IGL01918:Mlip APN 9 77173999 missense probably damaging 1.00
IGL02079:Mlip APN 9 77239529 missense possibly damaging 0.71
IGL02561:Mlip APN 9 77181351 critical splice donor site probably null
R0393:Mlip UTSW 9 77239577 missense probably benign 0.02
R2091:Mlip UTSW 9 77164863 missense possibly damaging 0.58
R3725:Mlip UTSW 9 77190380 missense probably damaging 1.00
R5334:Mlip UTSW 9 77243676 missense probably damaging 1.00
R5591:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5686:Mlip UTSW 9 77347693 critical splice donor site probably null
R5820:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6125:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6187:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6803:Mlip UTSW 9 77190381 missense probably damaging 0.99
R6860:Mlip UTSW 9 77102393 makesense probably null
R7031:Mlip UTSW 9 77138553 missense probably benign 0.03
R7206:Mlip UTSW 9 77164862 missense probably damaging 0.96
R7326:Mlip UTSW 9 77164842 missense probably benign 0.24
R7506:Mlip UTSW 9 77164803 missense probably damaging 1.00
R7509:Mlip UTSW 9 77181396 missense probably damaging 0.99
R7563:Mlip UTSW 9 77112997 missense probably damaging 0.99
R7590:Mlip UTSW 9 77230043 missense probably benign 0.15
R7615:Mlip UTSW 9 77230483 missense probably damaging 1.00
R7664:Mlip UTSW 9 77138546 missense possibly damaging 0.90
R7755:Mlip UTSW 9 77229556 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTAGACCCCGTTGTCAAGGAG -3'
(R):5'- AGATGTGAGAACCTGTCCTGC -3'

Sequencing Primer
(F):5'- GAGCCACTTGAGAGAGATTTCTTAG -3'
(R):5'- AGAACCTGTCCTGCGCCTG -3'
Posted On2016-10-26