Incidental Mutation 'R5592:Ogdh'
ID437577
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
MMRRC Submission 043144-MU
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 6316763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000093350] [ENSMUST00000101554] [ENSMUST00000135124] [ENSMUST00000140765]
Predicted Effect probably null
Transcript: ENSMUST00000003461
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081894
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081894
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093350
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093350
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101554
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135124
Predicted Effect probably benign
Transcript: ENSMUST00000140765
Meta Mutation Damage Score 0.9236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Galnt16 T C 12: 80,588,519 V343A probably damaging Het
Gimap4 A T 6: 48,691,158 E154D probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Pitpnm2 T C 5: 124,142,149 E112G probably damaging Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rb1 A G 14: 73,211,747 Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vav1 A G 17: 57,304,835 Y483C probably benign Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0328:Ogdh UTSW 11 6347216 missense probably benign 0.01
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6334626 missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6350655 nonsense probably null
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R4796:Ogdh UTSW 11 6340570 missense probably benign 0.01
R5333:Ogdh UTSW 11 6352126 missense probably damaging 1.00
R6318:Ogdh UTSW 11 6349390 missense probably damaging 0.99
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R7990:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAACTGCAAGGATCCCAGG -3'
(R):5'- TCTATGAGTGGGCCAACGATG -3'

Sequencing Primer
(F):5'- GAGAGGTCTAGAGTTCAATTCTCAGC -3'
(R):5'- TGGGCCAACGATGAGAGG -3'
Posted On2016-10-26