Incidental Mutation 'R0063:Irs1'
ID43758
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
MMRRC Submission 038355-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R0063 (G1)
Quality Score220
Status Validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82288859 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 545 (E545D)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect probably damaging
Transcript: ENSMUST00000069799
AA Change: E545D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: E545D

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,861,048 R245* probably null Het
4930563I02Rik T A 14: 60,096,028 probably benign Het
9330182L06Rik T C 5: 9,440,709 probably benign Het
Acss1 T C 2: 150,627,292 T435A probably damaging Het
Aoc2 T A 11: 101,326,071 S327T probably damaging Het
Arid5a T A 1: 36,318,564 Y252N probably damaging Het
AU040320 T C 4: 126,839,672 Y662H probably damaging Het
B4gat1 T A 19: 5,039,707 L244* probably null Het
Bcam C T 7: 19,766,848 V134I probably benign Het
Btbd16 A T 7: 130,823,166 T426S probably benign Het
Btn1a1 C T 13: 23,465,097 probably null Het
Cap2 T C 13: 46,638,032 probably benign Het
Capn8 T A 1: 182,602,112 D299E probably damaging Het
Cdipt G A 7: 126,979,600 V160I probably benign Het
Cep164 A G 9: 45,768,618 S1267P possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col3a1 T C 1: 45,330,541 probably benign Het
Cyb5r3 T C 15: 83,161,936 T60A probably benign Het
Dgkb T G 12: 38,604,113 S744A probably benign Het
Dock2 T A 11: 34,756,284 probably null Het
Ece1 C T 4: 137,948,581 T422M probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Eml3 C A 19: 8,938,478 A644D probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Foxp1 A G 6: 98,944,723 probably benign Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Il17rd G A 14: 27,082,733 C88Y probably damaging Het
Il17rd C A 14: 27,082,734 C88* probably null Het
Ino80c A G 18: 24,106,624 F160S probably damaging Het
Ints8 T C 4: 11,252,857 N75S probably damaging Het
Irf2bp1 C T 7: 19,005,847 R471C possibly damaging Het
Lama3 T C 18: 12,528,705 probably benign Het
Mast4 C A 13: 103,334,215 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Nat8f2 A T 6: 85,867,833 S182R possibly damaging Het
Nrcam G T 12: 44,550,028 V343F possibly damaging Het
Opn5 T C 17: 42,596,626 S120G probably damaging Het
Pdk2 T C 11: 95,032,480 H106R probably benign Het
Pkhd1 G A 1: 20,211,950 T2889I probably benign Het
Pkhd1l1 T A 15: 44,529,237 L1656H probably damaging Het
Plxna2 A T 1: 194,644,939 T394S probably benign Het
Pnpla8 T A 12: 44,282,832 C56S probably damaging Het
Prdm8 G T 5: 98,184,594 R118L probably damaging Het
Prkce T C 17: 86,482,111 probably benign Het
Ptprk T A 10: 28,263,767 Y163N probably damaging Het
Rbbp8 T A 18: 11,734,557 probably benign Het
Rnh1 A T 7: 141,164,196 probably null Het
Rtn4 T A 11: 29,705,527 probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc2a2 T C 3: 28,717,440 M173T probably damaging Het
Slc2a8 T A 2: 32,979,999 probably null Het
Tdpoz1 A T 3: 93,670,814 M221K probably benign Het
Tgm7 G T 2: 121,094,096 H533Q probably benign Het
Timm29 C A 9: 21,593,008 A17E probably benign Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tmem89 A G 9: 108,914,812 N60S probably benign Het
Tpx2 A G 2: 152,880,123 T212A probably damaging Het
Trio G T 15: 27,881,437 probably benign Het
Tulp2 T C 7: 45,520,860 probably benign Het
Uggt2 A G 14: 119,007,130 probably benign Het
Vmn2r5 T A 3: 64,503,800 E449V probably benign Het
Vwa8 A G 14: 79,164,216 probably benign Het
Xirp2 A G 2: 67,509,083 D556G probably damaging Het
Xrn1 T C 9: 95,969,535 L202P probably damaging Het
Zfp354a A T 11: 51,069,571 H203L probably damaging Het
Zfp53 A C 17: 21,508,105 R133S probably benign Het
Zfp787 C T 7: 6,132,323 probably null Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7991:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7993:Irs1 UTSW 1 82289884 missense probably benign
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense possibly damaging 0.87
Z1177:Irs1 UTSW 1 82290394 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACCCCAGGAGACATGGGCATATAG -3'
(R):5'- AAGTTCCTTCCGCAGTGTCACC -3'

Sequencing Primer
(F):5'- TGGGCATATAGCCATCATCAGTG -3'
(R):5'- GGAGCTGAGCAATTATATCTGC -3'
Posted On2013-05-29