Incidental Mutation 'R5592:Galnt16'
ID437586
Institutional Source Beutler Lab
Gene Symbol Galnt16
Ensembl Gene ENSMUSG00000021130
Gene Namepolypeptide N-acetylgalactosaminyltransferase 16
Synonyms5730405L21Rik, Galntl1
MMRRC Submission 043144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80518277-80630972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80588519 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000151829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021558] [ENSMUST00000218943] [ENSMUST00000219993]
Predicted Effect probably damaging
Transcript: ENSMUST00000021558
AA Change: V343A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021558
Gene: ENSMUSG00000021130
AA Change: V343A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
low complexity region 29 46 N/A INTRINSIC
Pfam:Glycos_transf_2 126 308 1.2e-24 PFAM
Pfam:Glyco_tranf_2_2 126 356 1.6e-9 PFAM
Pfam:Glyco_transf_7C 277 352 2.2e-10 PFAM
Blast:RICIN 362 395 1e-10 BLAST
RICIN 432 555 1.41e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218648
Predicted Effect probably damaging
Transcript: ENSMUST00000218943
AA Change: V343A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219993
AA Change: V343A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220065
Meta Mutation Damage Score 0.9440 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Gimap4 A T 6: 48,691,158 E154D probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Ogdh A T 11: 6,316,763 probably null Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Pitpnm2 T C 5: 124,142,149 E112G probably damaging Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rb1 A G 14: 73,211,747 Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vav1 A G 17: 57,304,835 Y483C probably benign Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Galnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Galnt16 APN 12 80592490 splice site probably null
IGL02614:Galnt16 APN 12 80576563 missense probably damaging 0.99
PIT4504001:Galnt16 UTSW 12 80592417 nonsense probably null
R0032:Galnt16 UTSW 12 80592469 missense probably damaging 1.00
R1109:Galnt16 UTSW 12 80590631 missense probably benign
R1560:Galnt16 UTSW 12 80601792 missense possibly damaging 0.77
R1595:Galnt16 UTSW 12 80590636 missense probably damaging 0.99
R1991:Galnt16 UTSW 12 80583656 missense probably damaging 1.00
R2103:Galnt16 UTSW 12 80583656 missense probably damaging 1.00
R4866:Galnt16 UTSW 12 80584077 missense probably damaging 1.00
R4972:Galnt16 UTSW 12 80572329 nonsense probably null
R5140:Galnt16 UTSW 12 80581299 missense possibly damaging 0.94
R5228:Galnt16 UTSW 12 80584048 missense probably damaging 1.00
R5414:Galnt16 UTSW 12 80584048 missense probably damaging 1.00
R6433:Galnt16 UTSW 12 80575903 missense probably benign 0.44
R6634:Galnt16 UTSW 12 80519170 start codon destroyed probably null 0.95
R7021:Galnt16 UTSW 12 80580052 missense probably damaging 0.99
R7534:Galnt16 UTSW 12 80597135 missense probably damaging 0.99
R7567:Galnt16 UTSW 12 80581310 critical splice donor site probably null
R7681:Galnt16 UTSW 12 80590639 missense probably damaging 1.00
R7802:Galnt16 UTSW 12 80581247 missense probably damaging 1.00
Z1177:Galnt16 UTSW 12 80572347 missense probably benign 0.14
Z1177:Galnt16 UTSW 12 80601810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACCTAGCACAAGAGCTCAC -3'
(R):5'- GTATCAGACATGGGGTTGGC -3'

Sequencing Primer
(F):5'- ACACCCCAGCATGTACTTTCATG -3'
(R):5'- TATCAGACATGGGGTTGGCAAATG -3'
Posted On2016-10-26