Incidental Mutation 'R5592:Galnt16'
ID 437586
Institutional Source Beutler Lab
Gene Symbol Galnt16
Ensembl Gene ENSMUSG00000021130
Gene Name polypeptide N-acetylgalactosaminyltransferase 16
Synonyms Galntl1, 5730405L21Rik
MMRRC Submission 043144-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R5592 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 80565245-80650672 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80635293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000151829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021558] [ENSMUST00000218943] [ENSMUST00000219993]
AlphaFold Q9JJ61
Predicted Effect probably damaging
Transcript: ENSMUST00000021558
AA Change: V343A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021558
Gene: ENSMUSG00000021130
AA Change: V343A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
low complexity region 29 46 N/A INTRINSIC
Pfam:Glycos_transf_2 126 308 1.2e-24 PFAM
Pfam:Glyco_tranf_2_2 126 356 1.6e-9 PFAM
Pfam:Glyco_transf_7C 277 352 2.2e-10 PFAM
Blast:RICIN 362 395 1e-10 BLAST
RICIN 432 555 1.41e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218648
Predicted Effect probably damaging
Transcript: ENSMUST00000218943
AA Change: V343A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219993
AA Change: V343A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220065
Meta Mutation Damage Score 0.9440 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,654,332 (GRCm39) F2I probably damaging Het
Adam17 C T 12: 21,384,138 (GRCm39) S454N probably damaging Het
Adcy1 A T 11: 7,089,088 (GRCm39) K501* probably null Het
Arhgap28 A T 17: 68,165,267 (GRCm39) M543K probably damaging Het
Art3 T A 5: 92,540,679 (GRCm39) Y141N probably damaging Het
Ccdc38 C T 10: 93,386,064 (GRCm39) T60I possibly damaging Het
Crmp1 A C 5: 37,422,609 (GRCm39) I139L probably benign Het
Cul9 G A 17: 46,831,517 (GRCm39) L1566F probably benign Het
Cysltr2 T C 14: 73,266,931 (GRCm39) K260E probably benign Het
Drd1 A T 13: 54,208,190 (GRCm39) M1K probably null Het
Flii T G 11: 60,611,225 (GRCm39) M449L probably benign Het
Gimap4 A T 6: 48,668,092 (GRCm39) E154D probably damaging Het
Glmp T G 3: 88,233,333 (GRCm39) probably benign Het
Glt1d1 A T 5: 127,734,183 (GRCm39) D119V probably benign Het
Gm5930 C T 14: 44,568,886 (GRCm39) M245I probably benign Het
Golgb1 T A 16: 36,746,125 (GRCm39) H2901Q probably benign Het
Krt12 C T 11: 99,311,650 (GRCm39) V184I probably benign Het
Lyst T G 13: 13,917,918 (GRCm39) I3326S probably damaging Het
Mier3 T A 13: 111,843,195 (GRCm39) Y182* probably null Het
Mlip G A 9: 77,137,764 (GRCm39) S381L probably damaging Het
Mmp25 A G 17: 23,859,176 (GRCm39) V157A possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Ms4a6c A G 19: 11,458,496 (GRCm39) probably benign Het
Ms4a6c A G 19: 11,457,641 (GRCm39) probably benign Het
Muc19 T C 15: 91,828,199 (GRCm39) noncoding transcript Het
Mucl3 T C 17: 35,954,535 (GRCm39) Y9C probably damaging Het
Mycbp2 C A 14: 103,432,113 (GRCm39) M2308I probably benign Het
Myo1a G T 10: 127,549,908 (GRCm39) V463F probably damaging Het
Ogdh A T 11: 6,266,763 (GRCm39) probably null Het
Or52h9 A T 7: 104,202,938 (GRCm39) N271Y probably benign Het
Or5l14 A G 2: 87,792,684 (GRCm39) L184P probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Paip1 C A 13: 119,587,334 (GRCm39) D124E probably damaging Het
Pdcd11 T A 19: 47,091,164 (GRCm39) N379K probably benign Het
Pitpnm2 T C 5: 124,280,212 (GRCm39) E112G probably damaging Het
Prrg4 T C 2: 104,663,123 (GRCm39) Y161C probably benign Het
Rb1 A G 14: 73,449,187 (GRCm39) Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 (GRCm39) M56K probably benign Het
Scarf1 A T 11: 75,416,513 (GRCm39) T652S probably benign Het
Slc16a5 A G 11: 115,363,608 (GRCm39) K423R probably benign Het
Sptan1 C T 2: 29,876,731 (GRCm39) probably benign Het
Ssrp1 T C 2: 84,875,863 (GRCm39) I574T probably benign Het
Synm A G 7: 67,409,264 (GRCm39) L38P probably damaging Het
Ubqln4 T G 3: 88,464,171 (GRCm39) M224R probably damaging Het
Uroc1 A G 6: 90,332,326 (GRCm39) N561S probably damaging Het
Vav1 A G 17: 57,611,835 (GRCm39) Y483C probably benign Het
Vps13a G A 19: 16,702,935 (GRCm39) L673F probably damaging Het
Zfp418 G T 7: 7,184,314 (GRCm39) K92N possibly damaging Het
Other mutations in Galnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Galnt16 APN 12 80,639,264 (GRCm39) splice site probably null
IGL02614:Galnt16 APN 12 80,623,337 (GRCm39) missense probably damaging 0.99
PIT4504001:Galnt16 UTSW 12 80,639,191 (GRCm39) nonsense probably null
R0032:Galnt16 UTSW 12 80,639,243 (GRCm39) missense probably damaging 1.00
R1109:Galnt16 UTSW 12 80,637,405 (GRCm39) missense probably benign
R1560:Galnt16 UTSW 12 80,648,566 (GRCm39) missense possibly damaging 0.77
R1595:Galnt16 UTSW 12 80,637,410 (GRCm39) missense probably damaging 0.99
R1991:Galnt16 UTSW 12 80,630,430 (GRCm39) missense probably damaging 1.00
R2103:Galnt16 UTSW 12 80,630,430 (GRCm39) missense probably damaging 1.00
R4866:Galnt16 UTSW 12 80,630,851 (GRCm39) missense probably damaging 1.00
R4972:Galnt16 UTSW 12 80,619,103 (GRCm39) nonsense probably null
R5140:Galnt16 UTSW 12 80,628,073 (GRCm39) missense possibly damaging 0.94
R5228:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 1.00
R5414:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 1.00
R6433:Galnt16 UTSW 12 80,622,677 (GRCm39) missense probably benign 0.44
R6634:Galnt16 UTSW 12 80,565,944 (GRCm39) start codon destroyed probably null 0.95
R7021:Galnt16 UTSW 12 80,626,826 (GRCm39) missense probably damaging 0.99
R7534:Galnt16 UTSW 12 80,643,909 (GRCm39) missense probably damaging 0.99
R7567:Galnt16 UTSW 12 80,628,084 (GRCm39) critical splice donor site probably null
R7681:Galnt16 UTSW 12 80,637,413 (GRCm39) missense probably damaging 1.00
R7802:Galnt16 UTSW 12 80,628,021 (GRCm39) missense probably damaging 1.00
R7983:Galnt16 UTSW 12 80,648,598 (GRCm39) missense probably benign 0.00
R8678:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 0.98
R8750:Galnt16 UTSW 12 80,644,879 (GRCm39) missense probably benign 0.18
R8944:Galnt16 UTSW 12 80,623,314 (GRCm39) missense probably damaging 1.00
R9386:Galnt16 UTSW 12 80,644,880 (GRCm39) missense probably damaging 0.99
Z1177:Galnt16 UTSW 12 80,648,584 (GRCm39) missense probably damaging 1.00
Z1177:Galnt16 UTSW 12 80,619,121 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTACCTAGCACAAGAGCTCAC -3'
(R):5'- GTATCAGACATGGGGTTGGC -3'

Sequencing Primer
(F):5'- ACACCCCAGCATGTACTTTCATG -3'
(R):5'- TATCAGACATGGGGTTGGCAAATG -3'
Posted On 2016-10-26