Incidental Mutation 'R5592:Vav1'
ID437598
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission 043144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R5592 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57304835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 483 (Y483C)
Ref Sequence ENSEMBL: ENSMUSP00000126694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
Predicted Effect probably benign
Transcript: ENSMUST00000005889
AA Change: Y507C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: Y507C

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112870
AA Change: Y507C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: Y507C

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169220
AA Change: Y483C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: Y483C

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174878
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A T 1: 85,726,611 F2I probably damaging Het
Adam17 C T 12: 21,334,137 S454N probably damaging Het
Adcy1 A T 11: 7,139,088 K501* probably null Het
Arhgap28 A T 17: 67,858,272 M543K probably damaging Het
Art3 T A 5: 92,392,820 Y141N probably damaging Het
Ccdc38 C T 10: 93,550,202 T60I possibly damaging Het
Crmp1 A C 5: 37,265,265 I139L probably benign Het
Cul9 G A 17: 46,520,591 L1566F probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dpcr1 T C 17: 35,643,643 Y9C probably damaging Het
Drd1 A T 13: 54,054,171 M1K probably null Het
Flii T G 11: 60,720,399 M449L probably benign Het
Galnt16 T C 12: 80,588,519 V343A probably damaging Het
Gimap4 A T 6: 48,691,158 E154D probably damaging Het
Glmp T G 3: 88,326,026 probably benign Het
Glt1d1 A T 5: 127,657,119 D119V probably benign Het
Gm5930 C T 14: 44,331,429 M245I probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golgb1 T A 16: 36,925,763 H2901Q probably benign Het
Krt12 C T 11: 99,420,824 V184I probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mier3 T A 13: 111,706,661 Y182* probably null Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mmp25 A G 17: 23,640,202 V157A possibly damaging Het
Ms4a6c A G 19: 11,480,277 probably benign Het
Ms4a6c A G 19: 11,481,132 probably benign Het
Muc19 T C 15: 91,930,314 noncoding transcript Het
Mycbp2 C A 14: 103,194,677 M2308I probably benign Het
Myo1a G T 10: 127,714,039 V463F probably damaging Het
Ogdh A T 11: 6,316,763 probably null Het
Olfr1157 A G 2: 87,962,340 L184P probably damaging Het
Olfr651 A T 7: 104,553,731 N271Y probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paip1 C A 13: 119,450,798 D124E probably damaging Het
Pdcd11 T A 19: 47,102,725 N379K probably benign Het
Pitpnm2 T C 5: 124,142,149 E112G probably damaging Het
Prrg4 T C 2: 104,832,778 Y161C probably benign Het
Rb1 A G 14: 73,211,747 Y648H probably damaging Het
Rpa3 A T 6: 8,257,694 M56K probably benign Het
Scarf1 A T 11: 75,525,687 T652S probably benign Het
Slc16a5 A G 11: 115,472,782 K423R probably benign Het
Sptan1 C T 2: 29,986,719 probably benign Het
Ssrp1 T C 2: 85,045,519 I574T probably benign Het
Synm A G 7: 67,759,516 L38P probably damaging Het
Ubqln4 T G 3: 88,556,864 M224R probably damaging Het
Uroc1 A G 6: 90,355,344 N561S probably damaging Het
Vps13a G A 19: 16,725,571 L673F probably damaging Het
Zfp418 G T 7: 7,181,315 K92N possibly damaging Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
Last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7474:Vav1 UTSW 17 57299102 missense probably benign 0.07
R7665:Vav1 UTSW 17 57297086 missense probably damaging 1.00
Z1176:Vav1 UTSW 17 57303853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57303040 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CGCTGATACTCACAACACCTTG -3'
(R):5'- TGTCCTTTGAAAGAAAGCCAAG -3'

Sequencing Primer
(F):5'- GTCTCACAATAGTTCCCTGAAGCTG -3'
(R):5'- GCTTCTGAGGGAGACACTATC -3'
Posted On2016-10-26