Incidental Mutation 'R5593:Itpkb'
ID437606
Institutional Source Beutler Lab
Gene Symbol Itpkb
Ensembl Gene ENSMUSG00000038855
Gene Nameinositol 1,4,5-trisphosphate 3-kinase B
Synonyms
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180330485-180424802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180334096 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 596 (S596P)
Ref Sequence ENSEMBL: ENSMUSP00000069851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070181]
PDB Structure
Crystal Structure of the Catalytic and CaM-Binding domains of Inositol 1,4,5-Trisphosphate 3-Kinase B [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050581
SMART Domains Protein: ENSMUSP00000050698
Gene: ENSMUSG00000055676

DomainStartEndE-ValueType
Gp_dh_N 2 154 5.53e-95 SMART
Pfam:Gp_dh_C 159 316 5.8e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070181
AA Change: S596P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069851
Gene: ENSMUSG00000038855
AA Change: S596P

DomainStartEndE-ValueType
low complexity region 68 106 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
low complexity region 595 618 N/A INTRINSIC
Pfam:IPK 722 933 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195043
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a block of thymocyte development at the double positive stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Itpkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Itpkb APN 1 180332993 missense probably benign
IGL01733:Itpkb APN 1 180333169 missense possibly damaging 0.50
IGL01812:Itpkb APN 1 180420286 missense probably damaging 1.00
IGL01965:Itpkb APN 1 180332405 missense probably damaging 1.00
IGL02447:Itpkb APN 1 180421354 splice site probably benign
IGL03143:Itpkb APN 1 180333368 missense probably benign
IGL03228:Itpkb APN 1 180413999 missense probably damaging 1.00
lahar UTSW 1 180327225 unclassified probably benign
magma UTSW 1 180413975 missense probably damaging 1.00
Purpura UTSW 1 180334096 missense probably damaging 1.00
Pyroclastic UTSW 1 180334253 intron probably benign
volcano UTSW 1 180421315 missense probably damaging 1.00
IGL02991:Itpkb UTSW 1 180327714 unclassified probably benign
R0071:Itpkb UTSW 1 180332765 missense probably damaging 1.00
R0471:Itpkb UTSW 1 180418255 missense probably damaging 0.98
R0616:Itpkb UTSW 1 180421736 missense probably damaging 1.00
R1567:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2060:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2474:Itpkb UTSW 1 180334151 missense probably damaging 1.00
R3022:Itpkb UTSW 1 180418323 missense probably damaging 0.96
R3792:Itpkb UTSW 1 180333173 missense possibly damaging 0.81
R3831:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3833:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3967:Itpkb UTSW 1 180327798 unclassified probably benign
R3968:Itpkb UTSW 1 180327798 unclassified probably benign
R4735:Itpkb UTSW 1 180418215 missense probably damaging 1.00
R4774:Itpkb UTSW 1 180418194 missense probably damaging 1.00
R4807:Itpkb UTSW 1 180334875 intron probably benign
R4895:Itpkb UTSW 1 180413895 missense probably damaging 1.00
R5514:Itpkb UTSW 1 180413909 missense probably damaging 1.00
R5633:Itpkb UTSW 1 180327225 unclassified probably benign
R5772:Itpkb UTSW 1 180334253 intron probably benign
R5898:Itpkb UTSW 1 180421315 missense probably damaging 1.00
R5903:Itpkb UTSW 1 180413975 missense probably damaging 1.00
R7060:Itpkb UTSW 1 180333130 missense probably damaging 1.00
X0066:Itpkb UTSW 1 180421780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTAGCTGCCAAGAGATG -3'
(R):5'- TTATGACTTTACCAGAGCCCTGC -3'

Sequencing Primer
(F):5'- TGCCAAGAGATGCCCCCAG -3'
(R):5'- CCAGGATGATGCACGGAGC -3'
Posted On2016-10-26