Incidental Mutation 'R5593:Sdk1'
ID437619
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141956124 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 509 (I509N)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: I249N

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: I249N

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085774
AA Change: I509N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: I509N

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Meta Mutation Damage Score 0.3098 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGACTCTCATAGTGCCAGG -3'
(R):5'- GGAGTTCACAGTAGGTTCTCAG -3'

Sequencing Primer
(F):5'- ACAATCCCCTCAGTGATGGTG -3'
(R):5'- TCACAGTAGGTTCTCAGAGAATGGTC -3'
Posted On2016-10-26