Incidental Mutation 'R5593:Cpa5'
ID 437621
Institutional Source Beutler Lab
Gene Symbol Cpa5
Ensembl Gene ENSMUSG00000029788
Gene Name carboxypeptidase A5
Synonyms
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R5593 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 30611010-30631745 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30630849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 370 (I370T)
Ref Sequence ENSEMBL: ENSMUSP00000110792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062758] [ENSMUST00000115138] [ENSMUST00000115139] [ENSMUST00000165949]
AlphaFold Q8R4H4
Predicted Effect probably benign
Transcript: ENSMUST00000062758
AA Change: I370T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057722
Gene: ENSMUSG00000029788
AA Change: I370T

DomainStartEndE-ValueType
Pfam:Propep_M14 43 117 5.6e-23 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115138
SMART Domains Protein: ENSMUSP00000110791
Gene: ENSMUSG00000029788

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 9.9e-26 PFAM
Zn_pept 139 395 4.62e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115139
AA Change: I370T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110792
Gene: ENSMUSG00000029788
AA Change: I370T

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 4.6e-25 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165949
SMART Domains Protein: ENSMUSP00000126436
Gene: ENSMUSG00000029788

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 6.4e-26 PFAM
Zn_pept 139 309 3.6e-19 SMART
Meta Mutation Damage Score 0.2621 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed in mouse testes where the encoded protein is localized to the germ cells. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Cpa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cpa5 APN 6 30625927 splice site probably benign
IGL02577:Cpa5 APN 6 30626808 splice site probably benign
IGL03148:Cpa5 APN 6 30630437 missense probably damaging 1.00
IGL03341:Cpa5 APN 6 30626291 missense possibly damaging 0.57
R0836:Cpa5 UTSW 6 30623211 missense probably damaging 1.00
R1437:Cpa5 UTSW 6 30624655 missense probably damaging 1.00
R2146:Cpa5 UTSW 6 30626822 missense probably damaging 1.00
R2285:Cpa5 UTSW 6 30615064 missense probably benign 0.09
R2334:Cpa5 UTSW 6 30624606 nonsense probably null
R4081:Cpa5 UTSW 6 30631229 missense probably benign 0.02
R4454:Cpa5 UTSW 6 30626324 missense possibly damaging 0.84
R4483:Cpa5 UTSW 6 30624626 missense probably damaging 1.00
R4758:Cpa5 UTSW 6 30615160 missense possibly damaging 0.67
R4771:Cpa5 UTSW 6 30612685 nonsense probably null
R4953:Cpa5 UTSW 6 30631364 missense possibly damaging 0.84
R5053:Cpa5 UTSW 6 30623272 missense probably damaging 1.00
R5392:Cpa5 UTSW 6 30630830 nonsense probably null
R5745:Cpa5 UTSW 6 30630437 missense probably damaging 1.00
R5900:Cpa5 UTSW 6 30615116 missense probably damaging 1.00
R6264:Cpa5 UTSW 6 30613985 missense probably damaging 1.00
R6268:Cpa5 UTSW 6 30615173 missense probably damaging 1.00
R6376:Cpa5 UTSW 6 30614045 missense probably benign
R6634:Cpa5 UTSW 6 30626364 missense probably damaging 1.00
R6814:Cpa5 UTSW 6 30614054 missense probably benign 0.03
R6872:Cpa5 UTSW 6 30614054 missense probably benign 0.03
R6989:Cpa5 UTSW 6 30625892 missense probably benign 0.06
R7205:Cpa5 UTSW 6 30630830 missense probably benign
R7499:Cpa5 UTSW 6 30630857 missense possibly damaging 0.81
R7864:Cpa5 UTSW 6 30631395 missense probably damaging 0.97
R8170:Cpa5 UTSW 6 30624595 missense probably benign 0.35
R9027:Cpa5 UTSW 6 30612605 start codon destroyed probably null 0.88
R9395:Cpa5 UTSW 6 30631281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTATCTACATACAGTGGTCCC -3'
(R):5'- AATTTCAGGCCGCATCCAGG -3'

Sequencing Primer
(F):5'- TGGTCCCCACTCGCAAC -3'
(R):5'- AGTTTTCCCCCTGGACCAATAGAC -3'
Posted On 2016-10-26