Incidental Mutation 'R5593:Cul1'
ID 437622
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
MMRRC Submission 043145-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5593 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 47430516-47503078 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 47462020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 196 (W196*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000143941] [ENSMUST00000146200] [ENSMUST00000146828] [ENSMUST00000152547]
AlphaFold Q9WTX6
Predicted Effect probably benign
Transcript: ENSMUST00000031697
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143941
SMART Domains Protein: ENSMUSP00000144845
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
PDB:1U6G|A 1 48 2e-26 PDB
SCOP:d1ldja2 17 47 3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146200
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146828
SMART Domains Protein: ENSMUSP00000121608
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
Pfam:Cullin 21 110 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152547
Predicted Effect probably null
Transcript: ENSMUST00000154391
AA Change: W196*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,888,027 (GRCm39) V120I unknown Het
Anpep T G 7: 79,491,794 (GRCm39) K69T probably benign Het
Appbp2 A T 11: 85,085,409 (GRCm39) I499K possibly damaging Het
Copb2 A G 9: 98,469,091 (GRCm39) probably null Het
Cpa5 T C 6: 30,630,848 (GRCm39) I370T probably benign Het
Cpn2 T C 16: 30,078,898 (GRCm39) T268A probably benign Het
Ctbp2 C A 7: 132,600,598 (GRCm39) R99I possibly damaging Het
Cysltr2 T C 14: 73,266,931 (GRCm39) K260E probably benign Het
Dyrk1a C A 16: 94,460,442 (GRCm39) Q33K possibly damaging Het
Elapor2 T A 5: 9,316,350 (GRCm39) L27Q probably benign Het
Epg5 T A 18: 78,000,689 (GRCm39) S542T probably damaging Het
Eps8l3 A T 3: 107,798,504 (GRCm39) probably benign Het
Evc2 A G 5: 37,544,321 (GRCm39) H690R probably damaging Het
Fam227a G A 15: 79,524,259 (GRCm39) probably benign Het
Gadl1 G T 9: 115,835,718 (GRCm39) G382V probably damaging Het
Gbf1 A G 19: 46,260,963 (GRCm39) Q1176R possibly damaging Het
Gdf9 A T 11: 53,324,558 (GRCm39) H109L probably damaging Het
Gsdmd T A 15: 75,738,856 (GRCm39) V411D probably damaging Het
Hdc T C 2: 126,460,504 (GRCm39) probably benign Het
Ifrd2 A G 9: 107,467,374 (GRCm39) D82G probably damaging Het
Itpkb T C 1: 180,161,661 (GRCm39) S596P probably damaging Het
Kcnmb3 A G 3: 32,546,096 (GRCm39) V8A possibly damaging Het
Lyst T G 13: 13,917,918 (GRCm39) I3326S probably damaging Het
Mcm9 G A 10: 53,414,393 (GRCm39) T229I probably damaging Het
Medag T A 5: 149,350,415 (GRCm39) F21L probably benign Het
Mefv A T 16: 3,533,315 (GRCm39) C319S probably benign Het
Mettl23 T A 11: 116,734,593 (GRCm39) V54D probably damaging Het
Mul1 A G 4: 138,166,543 (GRCm39) D199G probably damaging Het
Ncor1 A T 11: 62,260,130 (GRCm39) I266N probably damaging Het
Nek10 A T 14: 14,980,544 (GRCm38) K967* probably null Het
Nrcam A G 12: 44,606,483 (GRCm39) T410A probably damaging Het
Or1p1 A G 11: 74,179,618 (GRCm39) I49V possibly damaging Het
Or2b11 T C 11: 59,461,874 (GRCm39) R231G possibly damaging Het
Or52d13 C T 7: 103,109,592 (GRCm39) silent Het
Or52e4 T C 7: 104,705,711 (GRCm39) I86T probably damaging Het
Pate2 A T 9: 35,581,778 (GRCm39) D24V possibly damaging Het
Plcb3 T C 19: 6,932,117 (GRCm39) I1124V possibly damaging Het
Ptprc A T 1: 138,045,458 (GRCm39) probably benign Het
Rab6a T C 7: 100,257,378 (GRCm39) probably benign Het
Rnf208 G T 2: 25,133,345 (GRCm39) W13L possibly damaging Het
Rps6kl1 G T 12: 85,193,675 (GRCm39) Q139K possibly damaging Het
Sdk1 T A 5: 141,941,879 (GRCm39) I509N probably damaging Het
Sephs1 A G 2: 4,898,098 (GRCm39) I170V probably benign Het
Slc17a8 C T 10: 89,442,702 (GRCm39) D44N probably benign Het
Slc23a1 T A 18: 35,755,349 (GRCm39) I489F probably damaging Het
Slc25a19 A T 11: 115,507,418 (GRCm39) Y235N probably damaging Het
Slc47a2 A G 11: 61,233,486 (GRCm39) V40A probably benign Het
Slurp2 C T 15: 74,614,917 (GRCm39) V75I probably benign Het
Smc1b A C 15: 85,005,842 (GRCm39) M354R probably benign Het
Spice1 C A 16: 44,191,115 (GRCm39) A323E possibly damaging Het
Sptbn2 T A 19: 4,798,975 (GRCm39) V2015E probably damaging Het
Sptlc2 A C 12: 87,415,857 (GRCm39) F57V probably benign Het
Srsf1 A G 11: 87,938,705 (GRCm39) N14S possibly damaging Het
Ssh2 T A 11: 77,312,192 (GRCm39) D228E probably damaging Het
Synj2 A G 17: 6,088,390 (GRCm39) *1480W probably null Het
Syt14 A T 1: 192,613,231 (GRCm39) M523K probably damaging Het
Tff3 A T 17: 31,348,516 (GRCm39) V12E probably benign Het
Tgm2 C A 2: 157,969,262 (GRCm39) C371F probably damaging Het
Tmem260 A C 14: 48,711,501 (GRCm39) I197L probably benign Het
Unc5a A G 13: 55,152,747 (GRCm39) D887G possibly damaging Het
Vstm4 G T 14: 32,641,247 (GRCm39) A277S probably benign Het
Wdtc1 A T 4: 133,021,702 (GRCm39) probably null Het
Zan A G 5: 137,466,600 (GRCm39) F419S possibly damaging Het
Zfp317 G A 9: 19,558,584 (GRCm39) R266Q probably damaging Het
Zfp931 T A 2: 177,709,595 (GRCm39) T264S possibly damaging Het
Zpld2 T C 4: 133,920,350 (GRCm39) K605R probably damaging Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47,485,978 (GRCm39) missense probably benign
IGL02410:Cul1 APN 6 47,461,948 (GRCm39) missense probably damaging 1.00
IGL02458:Cul1 APN 6 47,502,542 (GRCm39) missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47,491,820 (GRCm39) missense probably damaging 0.98
IGL03065:Cul1 APN 6 47,472,015 (GRCm39) missense probably damaging 1.00
IGL03387:Cul1 APN 6 47,478,143 (GRCm39) missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47,500,139 (GRCm39) missense probably benign 0.01
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0436:Cul1 UTSW 6 47,500,707 (GRCm39) missense probably benign 0.16
R0746:Cul1 UTSW 6 47,495,222 (GRCm39) splice site probably null
R1103:Cul1 UTSW 6 47,494,111 (GRCm39) missense probably benign 0.03
R1471:Cul1 UTSW 6 47,491,820 (GRCm39) missense probably damaging 0.98
R1746:Cul1 UTSW 6 47,485,179 (GRCm39) missense probably damaging 0.98
R1852:Cul1 UTSW 6 47,497,764 (GRCm39) missense probably damaging 0.99
R1858:Cul1 UTSW 6 47,502,458 (GRCm39) splice site probably null
R1937:Cul1 UTSW 6 47,485,289 (GRCm39) missense probably benign 0.19
R1964:Cul1 UTSW 6 47,479,505 (GRCm39) missense probably damaging 0.98
R2985:Cul1 UTSW 6 47,479,441 (GRCm39) missense probably damaging 1.00
R4452:Cul1 UTSW 6 47,485,923 (GRCm39) nonsense probably null
R4653:Cul1 UTSW 6 47,461,897 (GRCm39) missense probably damaging 1.00
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R5141:Cul1 UTSW 6 47,497,773 (GRCm39) missense probably benign 0.04
R5328:Cul1 UTSW 6 47,485,251 (GRCm39) missense probably damaging 0.99
R5399:Cul1 UTSW 6 47,462,018 (GRCm39) splice site probably null
R5593:Cul1 UTSW 6 47,491,925 (GRCm39) missense probably damaging 0.99
R5616:Cul1 UTSW 6 47,500,722 (GRCm39) missense probably damaging 1.00
R5855:Cul1 UTSW 6 47,500,147 (GRCm39) missense probably benign 0.00
R6382:Cul1 UTSW 6 47,479,373 (GRCm39) missense probably damaging 1.00
R6670:Cul1 UTSW 6 47,494,068 (GRCm39) missense probably damaging 1.00
R6964:Cul1 UTSW 6 47,493,443 (GRCm39) missense probably benign 0.01
R8146:Cul1 UTSW 6 47,472,027 (GRCm39) missense possibly damaging 0.50
R8373:Cul1 UTSW 6 47,491,997 (GRCm39) missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47,492,010 (GRCm39) missense probably damaging 1.00
R8899:Cul1 UTSW 6 47,474,246 (GRCm39) missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47,495,173 (GRCm39) missense probably damaging 1.00
R9352:Cul1 UTSW 6 47,479,426 (GRCm39) missense probably benign 0.00
RF001:Cul1 UTSW 6 47,501,515 (GRCm39) missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47,494,067 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGTCAGAATCCTCATGGAC -3'
(R):5'- GTAAATCATTACAGGACCTCCCAAGG -3'

Sequencing Primer
(F):5'- TCCTCATGGACTGAAGCAGATTG -3'
(R):5'- TGAGACCCACAATGTGATGTC -3'
Posted On 2016-10-26