Incidental Mutation 'R5593:Nek10'
ID437651
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 14980544 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 967 (K967*)
Ref Sequence ENSEMBL: ENSMUSP00000153142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect probably null
Transcript: ENSMUST00000112630
AA Change: K967*
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: K967*

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112631
AA Change: K978*
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: K978*

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136826
SMART Domains Protein: ENSMUSP00000123151
Gene: ENSMUSG00000042567

DomainStartEndE-ValueType
Pfam:Pkinase 1 87 5.1e-13 PFAM
Pfam:Pkinase_Tyr 1 87 4.2e-8 PFAM
low complexity region 103 115 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224491
AA Change: K967*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 synonymous probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
Z1177:Nek10 UTSW 14 14853948 missense probably benign 0.00
Z1177:Nek10 UTSW 14 15001157 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGACAACAGCTTATTTCACATTC -3'
(R):5'- CTCCCCACATGCATACGTTG -3'

Sequencing Primer
(F):5'- CGTCCGTGAGATGAGATT -3'
(R):5'- GGTGAGAACAATTCCGTGGTCAC -3'
Posted On2016-10-26