Mutagenetix > Incidental Mutation

Incidental Mutation 'R5593:Epg5'

437667

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

043145-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R5593 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77957474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 542 (S542T)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably damaging
Transcript: ENSMUST00000044622
AA Change: S542T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: S542T

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Meta Mutation Damage Score

0.0979

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	C	T	11: 3,938,027	V120I	unknown	Het
9330182L06Rik	T	A	5: 9,266,350	L27Q	probably benign	Het
Anpep	T	G	7: 79,842,046	K69T	probably benign	Het
Appbp2	A	T	11: 85,194,583	I499K	possibly damaging	Het
Copb2	A	G	9: 98,587,038		probably null	Het
Cpa5	T	C	6: 30,630,849	I370T	probably benign	Het
Cpn2	T	C	16: 30,260,080	T268A	probably benign	Het
Ctbp2	C	A	7: 132,998,869	R99I	possibly damaging	Het
Cul1	G	A	6: 47,485,086	W196*	probably null	Het
Cul1	T	C	6: 47,514,991	F402L	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
Dyrk1a	C	A	16: 94,659,583	Q33K	possibly damaging	Het
Eps8l3	A	T	3: 107,891,188		probably benign	Het
Evc2	A	G	5: 37,386,977	H690R	probably damaging	Het
Fam227a	G	A	15: 79,640,058		probably benign	Het
Gadl1	G	T	9: 116,006,650	G382V	probably damaging	Het
Gbf1	A	G	19: 46,272,524	Q1176R	possibly damaging	Het
Gdf9	A	T	11: 53,433,731	H109L	probably damaging	Het
Gm7534	T	C	4: 134,193,039	K605R	probably damaging	Het
Gsdmd	T	A	15: 75,867,007	V411D	probably damaging	Het
Hdc	T	C	2: 126,618,584		probably benign	Het
Ifrd2	A	G	9: 107,590,175	D82G	probably damaging	Het
Itpkb	T	C	1: 180,334,096	S596P	probably damaging	Het
Kcnmb3	A	G	3: 32,491,947	V8A	possibly damaging	Het
Lyst	T	G	13: 13,743,333	I3326S	probably damaging	Het
Mcm9	G	A	10: 53,538,297	T229I	probably damaging	Het
Medag	T	A	5: 149,426,950	F21L	probably benign	Het
Mefv	A	T	16: 3,715,451	C319S	probably benign	Het
Mettl23	T	A	11: 116,843,767	V54D	probably damaging	Het
Mul1	A	G	4: 138,439,232	D199G	probably damaging	Het
Ncor1	A	T	11: 62,369,304	I266N	probably damaging	Het
Nek10	A	T	14: 14,980,544	K967*	probably null	Het
Nrcam	A	G	12: 44,559,700	T410A	probably damaging	Het
Olfr222	T	C	11: 59,571,048	R231G	possibly damaging	Het
Olfr59	A	G	11: 74,288,792	I49V	possibly damaging	Het
Olfr607	C	T	7: 103,460,385		silent	Het
Olfr677	T	C	7: 105,056,504	I86T	probably damaging	Het
Pate2	A	T	9: 35,670,482	D24V	possibly damaging	Het
Plcb3	T	C	19: 6,954,749	I1124V	possibly damaging	Het
Ptprc	A	T	1: 138,117,720		probably benign	Het
Rab6a	T	C	7: 100,608,171		probably benign	Het
Rnf208	G	T	2: 25,243,333	W13L	possibly damaging	Het
Rps6kl1	G	T	12: 85,146,901	Q139K	possibly damaging	Het
Sdk1	T	A	5: 141,956,124	I509N	probably damaging	Het
Sephs1	A	G	2: 4,893,287	I170V	probably benign	Het
Slc17a8	C	T	10: 89,606,840	D44N	probably benign	Het
Slc23a1	T	A	18: 35,622,296	I489F	probably damaging	Het
Slc25a19	A	T	11: 115,616,592	Y235N	probably damaging	Het
Slc47a2	A	G	11: 61,342,660	V40A	probably benign	Het
Slurp2	C	T	15: 74,743,068	V75I	probably benign	Het
Smc1b	A	C	15: 85,121,641	M354R	probably benign	Het
Spice1	C	A	16: 44,370,752	A323E	possibly damaging	Het
Sptbn2	T	A	19: 4,748,947	V2015E	probably damaging	Het
Sptlc2	A	C	12: 87,369,083	F57V	probably benign	Het
Srsf1	A	G	11: 88,047,879	N14S	possibly damaging	Het
Ssh2	T	A	11: 77,421,366	D228E	probably damaging	Het
Synj2	A	G	17: 6,038,115	*1480W	probably null	Het
Syt14	A	T	1: 192,930,923	M523K	probably damaging	Het
Tff3	A	T	17: 31,129,542	V12E	probably benign	Het
Tgm2	C	A	2: 158,127,342	C371F	probably damaging	Het
Tmem260	A	C	14: 48,474,044	I197L	probably benign	Het
Unc5a	A	G	13: 55,004,934	D887G	possibly damaging	Het
Vstm4	G	T	14: 32,919,290	A277S	probably benign	Het
Wdtc1	A	T	4: 133,294,391		probably null	Het
Zan	A	G	5: 137,468,338	F419S	possibly damaging	Het
Zfp317	G	A	9: 19,647,288	R266Q	probably damaging	Het
Zfp931	T	A	2: 178,067,802	T264S	possibly damaging	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
R9742:Epg5	UTSW	18	77980955	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGCTGATTCCTGACTTCTC -3'
(R):5'- AGTACTAGGTCCCTCTGCATTG -3'

Sequencing Primer
(F):5'- GGGCTGATTCCTGACTTCTCTTTAG -3'
(R):5'- TTCAGCTTCTTACTGTTAACCGAGAG -3'

Posted On

2016-10-26